Caracterizao dos genes matK e rbcL e da variabilidade gentica ...

  • Published on
    10-Jan-2017

  • View
    212

  • Download
    0

Transcript

  • UNIVERSIDADE CATLICA DOM BOSCO PROGRAMA DE PS-GRADUAO EM BIOTECNOLOGIA

    INGRID BATISTA PINTO

    Caracterizao dos genes matK e rbcL e da variabilidade gentica entre os acessos de Araruta (Maranta arundinacea L.).

    CAMPO GRANDE

    2015

  • UNIVERSIDADE CATLICA DOM BOSCO PROGRAMA DE PS-GRADUAO EM BIOTECNOLOGIA

    Caracterizao dos genes matK e rbcL e da variabilidade gentica entre os acessos de Araruta (Maranta arundinacea L.).

    Autora: Ingrid Batista Pinto Orientadora: Carina Elisei de Oliveira

    Coorientadora: Marney Pascoli Cereda

    . "Dissertao apresentada, como parte das exigncias para obteno do ttulo de MESTRE EM BIOTECNOLOGIA, no Programa de Ps-Graduao em Biotecnologia da Universidade Catlica Dom Bosco - rea de concentrao: Biotecnologia Aplicada Agropecuria "

    Campo Grande, Mato Grasso do Sul, Fevereiro 2015.

  • ii

  • iii

  • iv

    EPGRAFE

    Os passos da Grande Obra correspondem aos da

    criao do Mundo, demonstrando uma analogia entre

    microcosmo e macrocosmo. Mas isto apenas uma

    analogia, porque, segundo os sbios antigos, o

    'Magisterius' no criao, e, sim, um processo gerador

    realizado pelo Artista que conduzido pela Natureza

    e est apenas acelerando seu prprio trabalho de

    purificao.

    Christian Balister.

  • v

    DEDICATRIA

    A minha famlia em especial ao meu

    Pai, Pedro Batista Pinto pela

    dedicao, carinho e por sempre ter

    me apoiado na busca e realizao

    dos meus sonhos.

  • vi

    AGRADECIMENTOS

    Deus pela concretizao deste trabalho, por ter me iluminado e por me dar fora

    interior para superar as dificuldades, me suprir em todas as minhas necessidades.

    s minhas orientadoras Professoras Carina Elisei de Oliveira e Marney Pascoli

    Cereda por me apresentar o caminho da cincia e principalmente, acreditarem em

    mim.

    A Dra. Josimara Nolasco Rondon, pelo incentivo e dicas valiosas.

    A Dra. Lucimara Chiari pelos ensinamentos.

    A Dra. Renata Dias, pela contribuio significativa nesse trabalho.

    minha famlia, ao meu pai Pedro Batista Pinto, meu filho Pedro Fernando B.

    Hormung e a minha Irm Irina Batista Pinto, pelo apoio e carinho prestados mesmo

    sem saberem exatamente, o que eu fao.

    Ao meu namorado pela imensa pacincia, colaborao, compreenso, amor,

    carinho, por todo incentivo e pelo companheirismo incondicional.

    Aos meus amigos de laboratrio Guilherme A. Abrantes Souza, que compartilhou

    ensinamento, ajudando-me em vrios momentos, e a Poliene Costa, pelas

    conversas e pela gratificante parceria.

    A tcnica do laboratrio Maria Helena pela colaborao e ajuda durante a execuo

    deste trabalho.

    A Capes/ CNPQ e a UCDB pela bolsa concedida.

    Enfim a todos que contriburam de forma direta ou indireta para resoluo deste

    trabalho o meu MUITO OBRIGADA.

  • vii

    BIOGRAFIA DO AUTOR

    Nascida em Campo Grande - MS em 28 de maio de 1984, Ingrid Batista Pinto, filha

    de Pedro Batista Pinto e Graa Maria Colavite Pinto. Teve uma infncia tranquila e

    feliz.

    Em 2003 entrou para o curso de Nutrio da Universidade Catlica Dom Bosco,

    onde cursou apenas dois anos, terminando a graduao na Universidade

    Anhanguera- Uniderp na mesma rea. Fez estgios em nutrio clnica no Hospital

    Regional e na Unidade de Alimentao e Nutrio da Santa Casa de Campo

    Grande.

    Trabalhou em empresas de Alimentao e em Hospitais como nutricionista.

    Em 2012 visando aperfeioar seus conhecimentos, decidiu se especializar iniciando

    o Programa de Ps Graduao Mestrado em Biotecnologia da UCDB, onde atravs

    da cincia encontrou seu espao e realizao.

  • viii

    SUMRIO

    1 INTRODUO ......................................................................................................... 1

    1.1 A famlia Marantaceae ....................................................................................... 1

    1.2 Maranta arundinacea L. ..................................................................................... 2

    1.3 Importncia Econmica de Maranta arundinacea . ............................................ 5

    1.4 Marcadores Moleculares ................................................................................. 10

    1.5 Marcador Molecular RAPD .............................................................................. 12

    1.6 PCR Convencional ........................................................................................... 15

    1.7 DNA barcoding ................................................................................................. 16

    1.7.1 MatK ............................................................................................................ 20

    1.7.2 rbcL .............................................................................................................. 21

    2 OBJETIVOS ........................................................................................................... 21

    REFERNCIAS ............................................................................................................ 22

    CAPTULO I:. Caracterizao dos genes matK e rbcL e da variabilidade

    gentica entre os acessos de Araruta (Maranta arundinacea L.)........................... 31

    Introduo .................................................................................................................... 33

    Material e Mtodos ...................................................................................................... 34

    Amostras .................................................................................................................... 34

    Obteno das amostras ............................................................................................. 34

    Avaliao do perfil gentico ....................................................................................... 35

    Extrao do material gentico .................................................................................... 35

    Verificao da quantidade e qualidade do DNA ........................................................ 36

    Desenho dos Primes (iniciadores) dos genes matK e rbcL ....................................... 37

    PCR convencional ..................................................................................................... 37

    Anlise das sequncias dos genes matK e rbcL........................................................ 38

    Marcadores RAPD ..................................................................................................... 38

    Anlise dos dados obtidos atravs de marcadores RAPD ........................................ 39

    Resultados e Discusso ................................................................................................ 40

    Variabilidade gentica ............................................................................................... 44

    Concluso ..................................................................................................................... 46

    Referncias Bibliogrficas ............................................................................................. 47

    Apndices ..................................................................................................................... 51

  • v

    LISTA DE TABELAS

    Tabela 1. Composio nutricional da araruta crua por 100 gramas ................................ 9

    CAPTULO I

    Tabela 1. Genes utilizados, primers e os nmeros de acesso no GenBank ................. 37

    Tabela 2. Lista dos primers utilizados com suas respectivas sequncias de bases ..... 37

    Tabela 3. Dados de quantificao via espectrofotometria das extraes de material

    gentico foliar de quatro acessos de araruta. A absorbncia (Abs) foi medida no

    comprimento de onda de 260 a 280 nanmetros .......................................................... 41

    Tabela 4. Lista dos primers e suas respectivas sequncias, nmero de fragmentos

    amplificados e nmero de fragmentos polimrficos obtidos dos quatro acessos .......... 44

    APNDICE

    Tabela 1. Anlise do acesso de Araruta Comum comparadas com sequncias

    depositadas no BOLD Systems de rbcL ........................................................................ 51

    Tabela 2. Anlise das seqncias SC, Guadalupe e Seta comparadas com

    sequncias depositadas no BOLD Systems de rbcL .................................................... 51

    Tabela 3. Anlise das sequncias Comum, SC, Guadalupe e Seta comparadas com

    sequncias depositadas no BOLD Systems de matK ................................................... 51

  • vi

    LISTA DE FIGURAS

    Figura 1. Aspecto geral da Araruta (Maranta arundinacea L.) ........................................ix

    Figura 2. Aspecto geral do rizoma da Araruta ................................................................. x

    Figura 3. Principais reas de ocorrncia de Maranta Arundinacea L ............................ 37

    Figura 4. Esquema da reao de Polimorfismos de DNA amplifocados ao acaso

    (RAPD) ........................................................................................................................ 137

    Figura 5. Regies mais utilizadas como DNA Barcoding em plantas ............................ 17

    Figura 6. Esquema do genoma do cloroplasto .............................................................. 19

    CAPTULO I

    Figura 1. Imagens dos quatro acessos de M. arundinacea .......................................... 37

    Figura 2. Dendograma obtido a partir da anlise de Neighbor-joining (NJ), dos

    acessos Comum, SC, Guadalupe e Seta, utilizando Siphonochilus decorus como

    outgroup. Os valores encontrados nos ramos indicam os valores de boostrap (>50)

    baseado em 1.000 interaes ....................................................................................... 44

    Figura 3. Dendograma de similaridade gentica, obtido a partir dos produtos de

    amplificao por RAPD para quatro gentipos de Araruta ............................................ 45

    APNDICE

    Figura 1. Resultado do sequenciamento de gene rbcL dos quatro acessos de M.

    arundinacea .................................................................................................................. 52

    Figura 2. Resultado do sequenciamento de gene matK dos quatro acessos de M.

    arundinacea .................................................................................................................. 54

    Figura 3. Padro eletrofortico obtido com primers OPF5 e OPAF5. PM: Peso

    Molecula 1kb plus. CO: Araruta Comum. SC: Araruta SC. G: Araruta Guadalupe e

    ST: Araruta Seta, C- controle negativo ......................................................................... 56

    Figura 4. Padro eletrofortico obtido com primers OPA1 e OPA2. PM: Peso

    Molecula 1kb plus. CO: Araruta Comum. SC: Araruta SC. G: Araruta Guadalupe e

    ST: Araruta Seta, C- controle negativo ..................................................................... 3757

    Figura 5. Padro eletrofortico obtido com primers OPA17. PM: Peso Molecula 1kb

    plus. CO: Araruta Comum. SC: Araruta SC. G: Araruta Guadalupe e ST: Araruta

    Seta, C- controle negativo ............................................................................................ 58

  • vii

    LISTA DE ABREVIATURAS E SMBOLOS

    LISTA DE ABREVIATURAS

    atpF - Gene que codifica as subunidade CFO I da ATP sintase

    atpH - Gene que codifica a subunidade CFO III da ATP sintase

    BLAST -Basic Local Alignment Search Tool

    CBOL - Consortium for the Barcode of Life

    CIA - clorofrmio: lcool isoamilico

    COI - Citocromo oxidase I

    dNTP Desoxirribonucleotideo trifosfato

    ddNTP Di Desoxirribonucleotideo trifosfato

    DNA cido desoxirribonucleico

    EDTA - cido etilenodiaminotetractico

    et al - E outros.

    IR (a ou b) - Large Inverted Reapets

    ITSs - Espacadores internos transcritos

    kb - Kilo pares de bases

    LSC - Large Single Copy Region

    matK Gene que codifica a proteina maturase K

    mtDNA - DNA mitochondrial

    ng - nanograma

    pb - Pares de bases

    PCR - Polymerase Chain Reaction

    PlantGDB - Plant Genomic Database

    psbA Gene que codifica a proteina D1 do fotossistema II do cloroplasto

    psbI Gene que codifica o polipeptideo I de massa molecular baixa do sistema de

    fotossistema II do cloroplasto

    psbK - Gene que codifica o polipeptideo K de massa molecular baixa, do sistema de

    fotossistema II

    RAPD - Random Amplification of Polymorphic DNA

    rbcL -Gene que codifica a grande subunidade da ribulose-1,5-bifosfato carboxilase/

    oxigenase (RuBisCo)

  • viii

    rDNA - DNA ribossomal

    RFLPs - Restriction Fragment Lenght Polymorfisms

    RNA Acido ribonucleico

    RNase Enzima que degrada especificamente o RNA

    rpoB - Gene que codifica a subunidade da RNA polimerase

    rpoC1 - Gene que codifica a subunidade da RNA polimerase

    sp - Espcie

    spp - Espcies

    SSC - Small Single Copy Region

    Taq Thermus aquaticus, bactria termfila da qual se obtm uma das DNAs

    polimerases termoestveis utilizadas em PCR.

    tRNA cido ribonucleico transportador

    trnH - Gene de tRNA

    trnK - Gene de Trna

    LISTA DE SMBOLOS

    C - Graus Celcius

    % - Percentagem

    h - Hora(s)

    G - grama

    L - Microlitro(s)

    M - Micromolar

    mg - Miligrama(s)

    mL - Mililitro(s)

    min - Minuto(s)

    s - Segundo(s)

  • ix

    RESUMO

    PINTO, I. B. Caracterizao dos Genes matK e rbcL e da

    Variabilidade Gentica entre os Acessos de Araruta (Maranta

    arundinacea L.). Campo Grande, 2015. (Dissertao Mestrado em

    Biotecnologia) Universidade Catlica Dom Bosco, Campo Grande,

    2015.

    Maranta arundinacea uma planta nativa da Amrica do Sul, apresenta potencial

    econmico como uma matria prima no convencional para amido, atravs de seus

    caules subterrneos denominados rizomas. Devido falta de informaes sobre o

    nmero de espcies, o risco de extino e o crescente interesse no uso e na

    comercializao de seu amido fazem da M.arundinacea uma espcie ideal para

    estudos moleculares. Assim, o objetivo deste trabalho foi a identificao de quatro

    acessos de M. arundinacea denominados de Comum, (CeTeAgro); SC, Guadalupe

    e Seta (EMBRAPA-CENERAGEM) atravs dos genes cloroplastidiais matK e o rbcL,

    e avaliar a similaridade gentica, atravs de marcadores moleculares RAPD. Para

    anlise de RAPD utilizou-se 25 primers, destes, o primer OPA 02 foi selecionado por

    apresentar maior nmero de bandas polimrficas. Atravs do coeficiente de

    similaridade de Jaccard, juntamente com o teste de UPGMA, foi possvel

    estabelecer dois grupos distintos, Grupo I (Comum) e Grupo II (SC, Guadalupe e

    Seta). A identificao dos acessos por meio dos genes cloroplastidiais matK e o

    rbcL, foram submetidas por busca BLAST (GenBank) e BOLD Systems, resultando

    em 99,66 a 100% de identidade para o gene matK e rbcL, respectivamente, dos

    quatro acessos estudados, comparados com M. arudinacea. A construo da rvore

    filogentica, utilizando o gene rbcL, realizada por Neighbor-Joining, observou-se

    aps a separao do grupo externo, um grande grupo de M. arundinacea contendo

    os acessos SC, Guadalupe, Seta e o acesso do banco de doados M. arundinacea

    (3845927560), no apresentado diferenas entre eles. Outro grupo interno foi

    constitudo por Comum e o acesso do banco de dados M. arundinacea

    (JQ592613.1), evidenciando que o Comum se diferenciou dos demais acessos SC,

    Guadalupe e Seta, entretanto indicando que todos os acessos so da espcie M.

    arundinacea.

    Palavras-chave: DNA Barcoding, Marantaceae, RAPD.

  • x

    ABSTRACT

    PINTO, I. B. Characterization of Genes matK and rbcL and Genetics

    variability between Arrowroot accesses (Maranta arundinacea L.).

    Campo Grande, 2015. (Master Master in Biotechnology) - Dom Bosco

    Catholic University, Campo Grande, 2015.

    Maranta arundinacea is a plant native to South America, has economic potential as a

    non-conventional raw material for starch, through its underground stems called

    rhizomes. Due to lack of information on the number of species at risk of extinction

    and the growing interest in the use and marketing of its starch M.arundinacea make

    an ideal species for molecular studies. The objective of this study was the

    identification of four hits M. arundinacea Joint denominated, (CeTeAgro); SC,

    Guadeloupe and Arrow (EMBRAPA-CENERAGEM) through the chloroplast genes

    matK and rbcL, and assess the genetic similarity using RAPD molecular markers.

    For RAPD analysis was performed using 25 primers, of these, the primer OPA 02

    was selected due to its higher number of polymorphic bands. Through the Jaccard

    similarity coefficient, together with the UPGMA test, it was possible to establish two

    groups, Group I (Common) and Group II (SC, Guadeloupe and Arrow). The

    identification of the accesses through the plastid rbcL gene and matK were

    submitted by BLAST search (GenBank) and BOLD Systems, resulting in 99.66 to

    100% Identity to the rbcL gene and matK, respectively, of the four accesses studied,

    M. arudinacea compared. The construction of the phylogenetic tree using the rbcL

    gene carried by neighbor-joining, was observed after separation of the outer group, a

    large group containing M. arundinacea SC accesses, Guadeloupe arrow and given

    access database M . arundinacea (3845927560), did not present differences

    between them. Another internal group consisted of Common and the database

    access M. arundinacea (JQ592613.1), showing that the Joint different from the other

    SC access, Guadeloupe and arrow, however, indicating that all accesses are the

    species M. arundinacea .

    Keywords: DNA Barcoding, Marantaceae, RAPD.

  • 1

    1 INTRODUO

    1.1 A Famlia Marantaceae

    Em 1890 O. G. Petersen descreveu a famlia Marantaceae, sendo que o

    nome da famlia foi uma homenagem ao botnico italiano Bartolomeo Maranta, que

    viveu entre 1500 e 1571.

    A famlia Marantaceae um grande grupo de plantas compostas por 530

    espcies e 31 gneros (KENNEDY, 1977; ANDERSSON, 1986; KENNEDY,1997,

    2000). Das 530 espcies conhecidas, cerca de 80% ocorrem na Amrica Tropical,

    9% na frica e 11% na sia (HAMMEL, 1986). Esta famlia pertencente ordem

    Zingiberales (NEVES et al., 2005). As espcies de Marantaceae apresentam

    distribuio pantropical e so tpicas de florestas midas tropicais, crescendo

    principalmente a margens de rios e clareiras, podendo tambm ser encontradas em

    locais com vegetao aberta em reas encharcadas e em depresses nas margens

    de estradas (COSTA et al., 2008).

    De acordo com Souza e Lorenzi (2005), no Brasil a famlia Marantaceae,

    possui 150 espcies, das quais o gnero mais representativo no pas Calathea

    seguido de Maranta. Dez gneros so encontrados na Amaznia brasileira:

    Calathea, Ischnosiphon, Monotagma, Hylaeanthe, Thalia, Maranta, Koernickanthe,

    Monophyllanthe, Saranthe e Myrosma (COSTA et al., 2008).

    As plantas da famlia Marantaceae so facilmente identificadas, pela

    combinao de folhas com nervuras paralelas e presena de um engrossamento do

    pecolo na juno entre este e a lmina foliar denominado pulvino, possuem rizomas

    subterrneos, com exceo de algumas espcies que o rizoma pode estar

    parcialmente fora da terra (rizomas areos) e as suas flores nascem em dupla,

    formando uma estrutura chamada de inflorescncia (COSTA et al., 2008).

    As marantceas possuem sementes com apenas um cotildone

    (monocotiledneas), raiz fasciculada e folhas com nervuras paralelas. As

    monocotiledneas representam 22% de todas as Angiospermas (COSTA et al.,

    2008).

    Os principais representantes da famlia Marantacea apresentam grande

    importncia como plantas ornamentais, sendo estas Calathea, Ctenanthe, Maranta

    e Stromanthe, e fonte de fibras como a espcie Ischnosiphon gracilis, conhecida

  • 2

    como arum, que utilizada para produo de cestas e criao de utenslios

    domsticos de ndios e caboclos (COSTA et al., 2008).

    As folhas das espcies de Calathea fragilis e Calathea lutea so muito

    utilizadas para embalar peixes, bolos de mandioca e milho, e outras espcies so

    utilizados na alimentao humana tais como Calathea allouia e M. arundinacea L.

    (ARNS, 1997; COSTA et. al., 2008). A espcie Calathea allouia, conhecida como

    ari, cultivada por ndios e caboclos da Amaznia, para a obteno de seus

    tubrculos, os quais so consumidos aps a coco. A espcie considerada mais

    importante economicamente M. arundinacea, que tem como principal atrativo o

    rizoma que consiste da parte comestvel que podem tambm ser consumido aps o

    cozimento ou usado para extrao do amido (COSTA et al., 2008).

    1.2 Maranta arundinacea L.

    A araruta uma planta herbcea cujo nome cientfico M. arundinacea L.

    (Figura 1), pertencente famlia Marantaceae e ordem Zingiberales. A araruta

    uma planta rizomatosa, que produz rizomas em forma de fuso, coberto por

    escamas, os rizomas podem chegar de 10 a 25 cm de comprimento, em algumas

    ocasies dependendo do solo at 30 cm (Figura 2). Nas condies tropicais

    caracteriza-se pelo pouco ou nenhum florescimento (PIO CORRA, 1984).

    Figura 1. Aspecto geral da Araruta (Maranta arundinacea L). Fonte:. Acesso em: 03 de nov. 2014.

    http://www.agrosoft.org.br/agropag/211821.htm#.VFvS0TTF_Qw

  • 3

    Figura 2. Aspecto geral do Rizoma da Araruta. Fonte: . Acesso em: 03 de nov. 2014.

    Vrios autores discorrem sobre a possvel origem e reas da ocorrncia

    desta planta, alguns a consideram nativa das Antilhas, Mxico e de outros pases

    da Amrica Central (BENTLEY e TRIMEN 1880). Segundo Len (1987) a planta

    nativa da Amrica do Sul e das Antilhas. Peckolt e Peckolt (1893) afirmam que so

    nativas do Brasil. Erdman e Erdman (1984) citam que as espcies crescem na

    Amrica do Sul, Sudeste da sia, Caribe, Filipinas e ndia (Figura 3).

    H indcios do cultivo da araruta pelos ndios h mais de 7000 anos atrs. Os

    vegetais mais cultivados nas roas dos caboclos e de ndios amaznicos nas terras

    baixas da Amrica do Sul eram a mandioca (Manihot esculenta), batata-doce

    (Ipomoea batatas) taioba ou tai (Xanthosoma sp.), ari (Maranta lutea), araruta

    (Maranta arundinacea), inhame (Dioscorea alata), cup (Cissus gongylodes) e

    amendoim (Arachis sp) (MARTINS, 2005).

    Os ndios Aruak, que habitavam desde o Amazonas at a regio do Caribe,

    cultivavam a araruta e as chamavam de planta "aruaque aru-aru", significando

    "refeio das refeies", pelo fato de considerarem especiais as refeies

    preparadas com o amido que destaca-se pela sua digestibilidade (NEVES et al.,

    2005).

    http://hortas.info/como-plantar-araruta

  • 4

    Os ndios extraiam o amido e utilizavam para diversas aplicaes como

    engrossar sopas, tratar diarreia (especialmente em crianas), fortificar parturientes e

    purificar o sangue. As substncias cidas contidas no macerado fresco dos rizomas

    tambm eram utilizadas como compressas contra feridas provocadas por flechas ou

    como antdoto nas picadas de insetos e outros animais peonhentos (SILVA e

    MONTEIRO, 1968).

    As indicaes da araruta na medicina tradicional so relatadas para

    convalescena, dispepsia, irritao do canal digestivo, acidez estomacal,

    machucados, fortificao de crianas e idosos, queimaduras de sol, picadas de

    cobras e de mosquitos, para os quais so utilizados os rizomas (BERNAL e

    CORREA, 1994; DELGADO e SIFUENTES, 1995; MILLIKEN e ALBERT, 1997;

    PECKOLT e PECKOLT; 1893; REVILLA, 2002).

    Figura 3. Principais reas de ocorrncia de Maranta arundinacea. Fonte: . Acesso em: 03 de nov. 2014.

    A araruta uma planta de fcil cultivo. No Brasil, adaptou-se pelas

    caractersticas climticas de chuvas bem distribudas e temperatura mdia mensal

    maior que 22C, em geral seu cultivo encontra boas condies em clima temperado

    e ao nvel do mar (MONTEIRO e PERESSIN, 2002).

    Em relao ao solo, a araruta prefere solos arenosos e profundos os quais

    so ideais por proporcionar um bom crescimento dos rizomas. O solo precisa ser

    arado com at 20 cm de profundidade e com bom teor de matria orgnica

    (COELHO et al., 2005).

    http://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxon=maranta+arundinacea&searchMenu=taxonomy&query=maranta+arundinaceahttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxon=maranta+arundinacea&searchMenu=taxonomy&query=maranta+arundinacea

  • 5

    Em regies tropicais e equatoriais, o cultivo da araruta pode ser realizado o

    ano inteiro, tendo como exigncia para o seu desenvolvimento presena de

    umidade. Entretanto em regies sub-tropicais ou tropicais de altitude, os meses

    mais indicados so (setembro-outubro a maro-abril), permanecendo a cultura em

    dormncia durante o perodo frio e/ou seco do ano (BRASIL, 2010). Apresenta

    resistncia a pragas e doenas, sendo que os nematides do gnero Meloidogyne

    podem causar danos aos rizomas (BRASIL, 2010).

    A colheita da araruta realizada entre 9 e 10 meses aps o plantio, quando

    as plantas apresentam as folhas amareladas e secas, tombadas sobre o solo. Os

    tratos culturais consistem de capinas e amontoas, que podem ser manuais ou

    mecanizadas. (MONTEIRO e PERESSIN, 2002, BRASIL, 2010). Aps a colheita,

    uma poro de rizoma destinada ao novo plantio e a outra para extrao do amido

    (MARTINS, 1943).

    Para a produo do amido os rizomas so processados na seguinte ordem

    descascamento e lavagem, desintegrao (liquidificador industrial), separao

    (peneira 60 tyler), resultando em leite de amido passando pela purificao (peneira

    200 tyler) novamente, pr secagem (filtro a vcuo) e secagem (flash -dryer 70oC), o

    resultado um p fino, branco e inodoro (LEONEL, 2007).

    1.3 Importncia Econmica de Maranta arundinacea

    Os amidos e seus derivados so importantes fontes de matria prima, pois

    so aplicados em diversas reas de interesse econmico, tais como fabricao de

    papis, adesivos, embalagens biodegradveis, indstria txtil, indstria

    farmacutica, na produo de cola e principalmente na indstria alimentcia. Suas

    caractersticas em alimentos permitem alterar ou controlar a textura, aparncia,

    umidade e consistncia (ZHAO e WHISTLER, 1994 apud MEDINA, 2008).

    Os amidos produzidos a partir de gros de cereais, leguminosas e tuberosas

    so importantes comercialmente, pois so muito utilizados nas indstrias,

    principalmente no setor alimentcio, tendo como principais fontes de matria prima

    milho, batata, trigo e mandioca (CEREDA et al., 2003). A produo mundial de

    amido de aproximadamente 48,5 milhes de toneladas de amido, sendo os EUA

    responsvel pela maior produo de amido de milho (24,6 milhes de toneladas) a

    Unio Europeia a maior fabricante de amido de batata (1,8 milho de toneladas) e

  • 6

    de trigo (2,8 milhes de toneladas), outros amidos produzidos mundialmente,

    principalmente o da mandioca, correspondem a 2,5 milhes de toneladas (GUILBOT

    e MERCIER, 1985; FRANCO et al., 2002).

    Pases da sia, em especial a China, produzem amidos alternativos com

    diferentes propriedades, tais como arroz (Oryza sativa), araruta (Maranta

    arundinacea), biri (Canna edulis), inhame (Dioscorea alata), feijo mugo (Vigna

    radiata) dentre outros (CEREDA et al., 2003).

    Os grnulos de amido apresentam forma e tamanhos diversos de acordo com

    o grupo de planta pertencente (cereais, razes, tubrculos e leguminosas),

    apresentando tambm caractersticas e propriedades funcionais diferentes, inclusive

    entre plantas da mesma espcie (CEREDA et al., 2002).

    Segundo Madineni et al., (2012) o amido da araruta contm grnulos que so

    de pequeno, mdio e grande (2,92-6,42 m) com tamanho mdio de 4,84 m, e L /

    D de 1,20 com arredondamento de 0,73. O amido tem 24,8% de teor de amilose

    com uma temperatura de gelatinizao de 74.8 oC.

    Possui temperatura relativamente alta de gelatinizao e resistncia ao

    cisalhamento mecnico. Portanto, apresenta textura satisfatria para alimentos

    industrializados em alta temperatura ou como agente estabilizador para produtos

    esterilizados tais como alimentos infantis e produtos processados em ultra-alta

    temperatura (UHT) (MADINENI et al., 2012).

    Estudos realizados com M. arundinacea, relatam diversas utilidades para

    essa planta.

    Os efeitos imunoestimulantes de extratos do rizoma de araruta, foram

    analisados in vitro utilizando tcnicas de cultura de clulas animais, e in vivo,

    usando ratinhos BALB / c. Os resultados indicaram que o extrato do rizoma de

    araruta estimularam a produo de IgM por clulas HB4C5 e imunoglobulina (IgG,

    IgA e IgM) in vitro. Alm disso, a anlise in vivo indicou que a dieta contendo

    extratos de araruta aumentou os nveis sricos de IgG, IgA e IgM em ratinhos,

    revelando os efeitos imunoestimuladores in vivo bem como in vitro ( KUMALASARI,

    et al., 2012).

    Estudo realizado em 1984 avaliou o potencial de produo de lcool

    combustvel a partir de biomassa de araruta suplementado com levedura. O resduo

    grosso demonstrou qualidades adequadas para produo de papel resistente

  • 7

    ruptura e dobramento. Alm de utilizao da araruta como alimentos, combustvel e

    recursos de fibras, ele tambm pode ajudar a reduzir a poluio ambiental resultante

    da descarga direta do subproduto metanol no utilizado (ERDMAN e ERDMAN,

    1984).

    A produo de amidos no convencionais visa principalmente obteno de

    produtos diferenciados, a serem comercializados em mercado especfico

    possibilitando a ascenso dos preos e a diminuio da competio entre empresas

    produtoras de fcula e farinha de mandioca, pela mesma matria prima, alm de

    proporcionar alimentos livres de glten, que os tornam recomendveis para pessoas

    que apresentam intolerncia alimentar a esta protena, evitando assim o consumo

    de qualquer produto contendo trigo, aveia, centeio, cevada e seus derivados.

    (CEREDA et al., 2002, CEREDA et al., 2003).

    Na Amrica latina a produo de amidos alternativos, tais como biri feita

    pela Colmbia. No Brasil a produo de amido da araruta, foi substituda pela

    mandioca por ser mais produtiva, entretanto inmeras espcies tais como, aafro,

    inhame, batata doce, taioba, gengibre, araruta entre outras, so matrias primas

    com potencial para a produo de amido (CEREDA et al., 2003).

    Segundo Cereda (2002), a maioria dos amidos no convencionais segue a

    mesma linha de produo da mandioca, sendo que no Brasil testes feitos em

    fecularias, com batata doce e araruta apresentaram resultados satisfatrios tanto

    em extrao quanto em qualidade.

    O preo do amido da araruta no mercado varia entre R$ 15,00 a R$ 20,00

    reais o quilo e no mercado internacional chega a alcanar preos ainda mais

    elevados (450 gramas custam cerca de US$ 22,19) (EBDA, 2013). Cerca de 50

    plantas bastam para consumo prprio, rendendo de 5 a 10 quilos de fcula (amido

    ou polvilho) ou de 15 a 20 quilos de farinha. Para produo comercial, ao menos

    500 metros quadrados so necessrios para o plantio (GLOBO RURAL, 2013). O

    amido da araruta, retirado do rizoma o principal recurso explorado nessa planta,

    tem caractersticas e qualidades consideradas inigualveis, conferindo leveza e alta

    digestibilidade aos confeitos preparados (NEVES et al., 2005).

    O mercado nacional e internacional de alimentos tem interesse em M.

    arundinacea especialmente pela elaborao de produtos destinados a confeitaria

    (LEONEL et al., 1998).

  • 8

    As caractersticas culinrias do amido, o destacam principalmente pela

    leveza dos biscoitos, mingaus e bolos, em substituio s farinhas de trigo, milho ou

    mandioca, alm de ser utilizada para diversos usos medicinais (COELHO et al.,

    2005).

    O amido da araruta pode ser qualificado atravs da limpeza, contedo de

    polpa e fibras, umidade, pH, viscosidade, cinzas e o mais importante, classificao

    atravs de sua cor que deve ser mais branca possvel (PURSEGLOVE, 1985). Suas

    caractersticas bsicas so de um p branco, inodoro e inspido (BERNAL e

    CORREA, 1994).

    O rizoma contm, alm de amido, celulose, protena, acar, mucilagem e

    sais minerais, betacaroteno, niacina, riboflavina, tiamina entre outros (Tabela 1),

    algumas alteraes desses componentes podem ocorrer devido a fatores como

    clima, grau de fertilidade do solo, dentre outros fatores biticos e abiticos

    (MARTINS, 1943).

    O cultivo das hortalias no-convencionais, tais como a araruta no Brasil

    realizado principalmente por agricultores familiares. O conhecimento para o cultivo e

    consumo destas plantas foi passado atravs das geraes. A maioria do cultivo

    atravs da agricultura familiar para consumo prprio, sem desgnio comercial

    (BRASIL, 2010).

    A araruta j foi muito cultivada no Brasil, mas perdeu espao nos ltimos 50

    anos, chegando quase extino, devido concorrncia de outros amidos

    produzidos em nvel industrial como a mandioca, milho, aveia, cevada e trigo, o

    cultivo da araruta foi sendo gradualmente substitudo, porm, o amido de mandioca

    no possui as mesmas caractersticas de fcil digestibilidade e capacidade de

    gelificao (SILVA et al., 2000). Portanto, devido a sua importncia fundamental a

    caracterizao do seu material gentico, atravs de marcadores moleculares, como

    meio de preservao e conservao de seu germoplasma, com a possibilidade

    futura da introduo de caractersticas fundamentais e que permanecem aos

    diferentes gentipos, para formao de uma espcie melhorada.

  • 9

    Tabela 1 - Composio nutricional da araruta crua por 100 gramas

    Nutrientes Unidade Valor por 100 g

    Relacionados

    gua g 80.75

    Calorias kcal 65

    Protenas g 4.24

    Lpides totais (gordura) g 0.2

    Carboidratos, por diferena g 13.39

    Fibra total diettica g 1.3

    Cinzas g 1.42

    Minerais

    Clcio, Ca mg 6

    Ferro, Fe mg 2.22

    Magnsio, Mg mg 25

    Fsforo, P mg 98

    Potssio, K mg 454

    Sdio, Na mg 26

    Zinco, Zn mg 0.63

    Cobre, Cu mg 0.121

    Mangans, Mn mg 0.174

    Selnio, Se mcg 0.7

    Vitaminas

    Vitamina C, cido ascrbico total mg 1.9

    Tiamina mg 0.143

    Riboflavina mg 0.059

    Niacina mg 1.693

    cido pantotnico mg 0.292

    Vitamina B6 mg 0.266

    Folato total mcg 338

    Vitamina B12 mcg 0

    Vitamina A UI 19

    Vitamina A, RAE mcg_RAE 1

    Lpides

    cidos graxos, total saturados g 0.039

    cidos graxos, total mono-insaturados g 0.004

    cidos graxos, total poli-insaturados g 0.092

    Fonte: USDA Nutrient Database for Standard Reference, Release 14 (Julho

    2001) A acesso em: 03 de nov.2014.

    http://www.unifesp.br/dis/servicos/nutri/nutri.php?id=2987

  • 10

    1.4 Marcadores Moleculares

    Com o advento das tcnicas moleculares os marcadores de DNA tornaram-

    se indicadores para o estudo de gentica de vrios organismos, includo as plantas.

    Estas tcnicas tornaram-se rotineiramente aplicadas em pesquisa sobre a

    biodiversidade, estudos de evoluo e biotecnologia. Os marcadores moleculares

    so caractersticas que identificam o perfil da molcula de DNA (fingerprinting) que

    podem ser herdados e so capazes de diferenciar dois ou mais indivduos (MILACH,

    1998).

    As tcnicas aplicadas aos estudos de marcadores moleculares tornaram-se

    cada vez mais rpidas, precisas e baratas, nas anlises de deteco das variaes

    genticas entre os organismos. No entanto, algumas tcnicas so mais adequadas

    do que outras.

    Um marcador molecular deve apresentar algumas caractersticas

    desejveis, como: (i) ser de natureza altamente polimrfica para uso em estudos de

    diversidade gentica; (ii) possuir herana codominante para a determinao de

    homozigose e ou heterozigose de organismos diplides; (iii) ocorrer com frequncia

    no genoma, de forma uniforme e distribuda; (iv) apresentar comportamentos

    seletivos neutros, pois as sequncias de DNA so neutras em condies

    ambientais; (v) fcil de ser detectado (disponibilidade): simples e rpido; (vi) ensaios

    fceis, rpidos e baratos; (vii) alta reprodutibilidade e (viii) fcil troca de dados entre

    os laboratrios (KUMAR et al., 2009).

    Entretanto, extremamente difcil encontrar um marcador molecular, que

    rena todos os critrios acima mencionados.

    Para avaliao e deteco do polimorfismo em nvel de DNA, h diversas

    tcnicas moleculares disponveis e a escolha da tcnica ideal depende do tipo de

    estudo a ser realizado. A escolha de um marcador deve ser determinada, quando

    preenche pelo menos algumas das caractersticas acima citadas (WEISING et al.,

    1995).

    Vrios tipos de marcadores moleculares so utilizados para avaliar o

    polimorfismo de DNA e so geralmente baseados na hibridao e/ou na reao em

    cadeia da polimerase (PCR). Na hibridizao, os perfis dos tamanhos dos

    fragmentos de restrio da molcula de DNA so visualizados por hibridao de

    uma sonda marcada com substncia radioativa e/ou fluorescente, a partir de um

  • 11

    fragmento de DNA de origem conhecida. A PCR baseada na amplificao in vitro

    de sequncias de DNA especficas ou loci, orientada por oligonucleotdeos

    especficos ou aleatrios (MATIOLI, 2001).

    Em relao ao tipo de marcador importante diferenciar aqueles que

    fornecem dados de um nico loci, daqueles que possuem mltiplos loci. Esta

    informao extremamente importante devido quantidade de informaes e

    interpretao dos dados (MATIOLI, 2001).

    Os marcadores multilocos utilizados em DNA fingerprinting, so as tcnicas

    denominadas de DNA polimrfico amplificado ao acaso (RAPD), polimorfismo de

    tamanho de fragmentos amplificados (AFLP), Microssatlites e Minissatlites, os

    quais so mais adequados para estudos de identificao gentica, teste de

    paternidade e estudo de variabilidade gentica intra-espcie. Enquanto os

    marcadores de Amplified Fragment Length Polymorphism (RFLPs) obtidos de DNA

    mitocondrial (mtDNA), DNA de cloroplasto (cpDNA), DNA ribosomal (rDNA) so

    mais apropriados para anlises de espcies relacionadas (interespcies) (MATIOLI,

    2001).

    O uso da tcnica da reao em cadeia da polimerase (PCR), utilizada para

    vrios marcadores, como Random Amplified Polymorphic DNA (RAPD) ou DNA

    amplificado ao acaso (WILLIAMS et al., 1990), AFLP ou polimorfismo de

    comprimento de fragmento amplificado (VOS et al., 1995) e marcadores

    microssatlites ou sequncias simples repetidas (SSR) (MORGANTE e OLIVIERI,

    1993).

    As informaes obtidas por meio dos marcadores moleculares so muito

    teis para auxiliar na identificao dos gentipos contrastantes em programas de

    melhoramento de plantas o qual incluem diversos padres para obteno de

    variabilidade gentica, seleo de indivduos superiores, avaliao de materiais

    genticos promissores para o comrcio. Nesses programas os usos de marcadores

    de DNA so aplicados no monitoramento e organizao da variabilidade gentica, a

    seleo assistida por marcadores moleculares no qual detecta diferenas gentico-

    moleculares, representando o futuro promissor na agricultura e a proteo de

    cultivares (FARALDO et al., 2003, FUKUDA et al., 1994; LEE, 1995).

    Os marcadores moleculares constituem ferramentas de grande importncia

    para a identificao e caracterizao dos acessos mantidos em Bancos de

    Germoplasma de vrias plantas tais como: mandioca, milho, feijo, soja, entre

  • 12

    outras, cujo principal objetivo a manuteno da variabilidade gentica (FALEIRO,

    2007).

    Sabe-se que muitos pesquisadores melhoristas, evitam trabalhar com

    materiais disponveis nas colees de gentipos silvestres e etnovariedades por

    falta de identificao e caracterizao de genes com potencial para melhoramento

    gentico (FARALDO et al., 2003; NASS, 2001).

    A escolha de genitores e o planejamento de cruzamento em programas de

    melhoramento gentico so etapas fundamentais para o sucesso do programa. Para

    balizar este processo so essenciais a realizao de caracterizao gentica

    apuradas e precisas da coleo de acesso do banco de germoplasma, a qual

    obtida com base na avaliao acurada de caractersticas morfolgicas, fisiolgicas e

    agronmicas, alm de dados de pedigree (FALEIRO, 2007).

    Dados adicionais sobre a diversidade gentica de potenciais genitores

    obtidos com base em marcadores moleculares podem auxiliar na escolha dos

    genitores e no planejamento dos cruzamentos visando o melhoramento do efeito da

    heterose e das recombinaes gnicas desejadas (FALEIRO, 2007).

    1.5 Marcador Molecular RAPD

    A tcnica de PCR permitiu o desenvolvimento de vrias classes de

    marcadores moleculares os quais so cada vez mais utilizados em vrias espcies

    de plantas. Dentre esses marcadores, destaca-se o Random Amplified Polymorphic

    DNA (RAPD) ou DNA amplificado ao acaso (WILLIAMS et al.,1990).

    A tcnica de RAPD (Figura 6) baseada na repetio cclica da extenso

    enzimtica de iniciadores, como pequenos primers complementares, que se

    hibridizam ao DNA e servem como molde na amplificao atravs da PCR. Os locos

    que apresentam duas sequncias alvo em fitas opostas com orientao e

    espaamento adequado so amplificados pelo processo de PCR (TINGEY et al.,

    1992). Nesse mtodo um nico primer utilizado o qual normalmente formado por

    diferentes combinaes das quatro bases nitrogenadas que apresentam uma

    sequncia predominante de bases citosina e guanina (C/G 60 a 80%) e com alvos

    desconhecidos. O RAPD tem sido adotado por alguns pesquisadores envolvidos no

    desenvolvimento de mtodos de identificao de cultivares, principalmente por ser

    uma tcnica simples que no requer nenhuma informao prvia sobre as

  • 13

    sequncias de nucleotdeos do genoma da espcie, alm de ser bastante acessvel

    e de custo relativamente baixo e pode ser utilizado sobre as informaes

    moleculares escassas (FRITSCH e RIESEBERG,1996; WEEDEN, 1992; MENEZES

    et al., 2002).

    Figura 4. Representao esquemtica da tcnica (RAPD).Fonte adaptada pela autora:

    Disponvel em: . Acesso em: 03 de nov. 2014.

    Por apresentarem primers de sequncia curta, h grande probabilidade de

    que esses primers encontrem regies do genoma onde se anelarem, fazendo com

    que diversos fragmentos de tamanhos diferentes resultem de uma reao

    (WILLIAMS et al., 1990).

    Os polimorfismos so identificados pela presena de um fragmento especfico

    de DNA amplificado em um determinado genoma, comparado ausncia do mesmo

    fragmento de outro genoma por apresentar de diferentes comprimentos, podem ser

    separados e distinguidos por eletroforese (TINGEY et al., 1992). Apresentam

    algumas limitaes por serem marcadores dominantes, ou seja, indivduos

    homozigotos dominantes e heterozigotos no podem ser diferenciados, pois ambos

    sero visualizados pela presena de uma banda no gel (WILLIAMS et al., 1990).

    Contudo existem muitos trabalhos demonstrando resultados de identificao de

    http://www.usask.ca/.../projects_2002/pawlin/resources/rapd1.jpg

  • 14

    acessos com marcadores RAPD, utilizados na alimentao humana, tais como

    mandioca, milho, arroz, crcuma longa e pimenta so alvos dessa tcnica.

    O uso da tcnica RAPD produz um grande nmero de marcadores

    moleculares, permitindo encontrar marcadores especficos de gneros, espcies,

    subespcies, ou raas, sendo de grande interesse para o estabelecimento de

    relaes taxonmicas (HADRYS et al., 1992; AAGAARD et al., 1995), para o

    estabelecimento de relaes filogenticas e diferenciao de espcies prximas

    (ARNOLD et. al., 1991; LINFANTE e AGUINAGALDE, 1996; WOLFF e MORGAN-

    RICHARDS, 1998), e para deteco de hbridos (DAEHLER e STRONG, 1997; DE

    GREEF e TRIEST, 1999; KUEHN et al., 1999).

    Nos estudos de Angel et al. (2008), utilizando 11 espcies de crcuma,

    testados com 20 primers, no total de 274 bandas foram geradas, das quais 264

    foram polimrficas revelando um elevado grau de polimorfismo, possibilitando a

    identificao da espcie.

    A tcnica de RAPD e ISSR foram utilizadas para avaliar a variao gentica

    entre 13 cultivares de Calathea em 11 espcies. No total, 262 bandas foram

    encontradas, das quais 252 eram polimrficas, resultando em alto grau de

    polimorfismo 96,1%. Assim, estes marcadores tm o potencial para a identificao

    de espcies / variedades e til em programas de melhoramento gentico (ROUT, et

    al.,2007).

    Outro estudo analisou a variabilidade gentica entre Aafro (Curcuma longa)

    entre 20 acessos obtidos de diferentes regies do Brasil, onde foram utilizados 45

    loci polimrficos. Atravs de teste estatstico AMOVA houve a formao de dois

    grupos. A proporo da variabilidade gentica existente entre os trs acessos pr-

    estabelecidos permitiu verificar 44,49% de variabilidade gentica entre os grupos

    (PINHEIRO et al., 2003).

    Estudos j publicados envolvendo plantas da mesma famlia, como o aafro

    e o gengibre, foram utilizados como referncia para o desenvolvimento deste

    trabalho, utilizando a M. arundinacea. Existem muitos trabalhos na literatura

    utilizando marcadores de DNA para a caracterizao da variabilidade gentica em

    muitas espcies de populaes naturais (JAGGI et al., 2000; BOUZAT, 2001).

  • 15

    1.6 PCR Convencional

    As tcnicas que envolvem o uso de DNA apresentam alto poder de

    resoluo, com as diferenas entre os indivduos detectadas nas sequncias de

    nucleotdeos distribudas pelo genoma (FERREIRA e GRATTAPAGLIA, 1998), que

    permitem a distino entre gentipos com elevada facilidade, utilizando primers

    pequenos e de sequncia arbitrria, revelando ser uma tcnica muito simples e de

    custo moderado, permitindo a anlise gentica de varias espcies (HADRYS et al.,

    1992).

    Diversas tcnicas esto disponveis, as baseadas na reao da polimerase

    em cadeia (PCR) oferecem vantagens em relao a outros mtodos, pois as

    quantidades de DNA utilizadas so mnimas na proporo de picogramas ou

    nanogramas, permitindo a amplificao do produto, resultando em molculas de

    DNA com sequncia homloga ao DNA, que serviu de origem e os perfis

    eletroforticos so obtidos com maior rapidez (FERREIRA e GRATTAPAGLIA,

    1998; GUIMARES, 1999; TAYLOR, 1993).

    Kary Mullis nos anos 80 desenvolveu a tcnica de PCR Polymerase Chain

    Reaction ou Reao em Cadeia de Polimerase, realizada em um termociclador,

    aparelho que permite a realizao de trs etapas fundamentais para amplificao do

    DNA, que so desnaturao, anelamento e extenso.

    A desnaturao do DNA consiste na elevao da temperatura a 92/95C e

    no rompimento das pontes de hidrognio, separando a fita dupla de DNA. As fitas

    simples de DNA so expostas, criando um molde, nas quais sero anelados o

    primer ou iniciador, complementando sua sequncia (EISENSTEIN, 1990,

    SCHEINERT et al., 2005). Na etapa de anelamento ocorre uma variao na

    temperatura de 35/60C dependendo essencialmente do tamanho e sequencia dos

    iniciadores utilizados, permitindo a hibridizao DNA-DNA de cada iniciador com as

    sequncias complementares da fita simples (molde) que flanqueiam a regio alvo.

    Na ltima etapa ocorre a extenso no sentido 5- 3, atravs da ativao da enzima

    DNA polimerase, em uma temperatura elevada 72C (TAYLOR, 1993) .

    Um fator importante deve-se aos seus stios de anelamentos que devem

    estar em uma distncia suficiente para que no ocorra o anelamento entre os

    primers, assim permitindo a sntese subsequente de um novo produto. Para uma

    amplificao perfeita se faz necessria padronizao da reao e esta consiste na

  • 16

    otimizao dos reagentes utilizados, como o tampo da Taq DNA polimerase,

    MgCl2, iniciadores (com pequenas sequncias de nucleotdeos, denominados de

    primers), desoxirribonucleotdeos trifosfatados (dATP, dCTP, dGTP,dTTP) e a

    enzima termoestvel Taq DNA polimerase, isolada da bactria termoflica Thermus

    aquaticus (EISENSTEIN, 1990).

    A quantidade de ciclos geralmente determinada pelo pesquisador e/ou de

    acordo com o tamanho do produto a ser amplificado e a especificidade do primer, o

    ciclo repetido por algumas dezenas de vezes, as fitas de DNA se multiplicam

    medida que os ciclos vo se repetindo e os primers consumidos, esses primers iro

    definir a sequncia a ser replicada, resultando na amplificao de uma determinada

    sequncia de DNA com bilhes de cpias (EISENSTEIN, 1990; MULLIS, 1987).

    1.7 DNA barcoding

    Nas plantas, as sequncias de DNA podem ser obtidas a partir de trs

    genomas: cloroplasto (cpDNA), mitocndria (mtDNA) e ncleo (nDNA). As variaes

    que ocorrem nesses genomas, tais como mutaes pontuais e rearranjos, incluindo

    inverses, delees e inseres, so os caracteres utilizados em estudos de

    filogenia (Figura 4).

    Estas sequncias de DNA de regies padro tm sido utilizadas como

    ferramentas para a identificao de espcies de organismos e so denominadas de

    barcoding (cdigo de barra).

    Segundo o - Consortium for the Barcode of Life - CBOL (2009), DNA

    barcoding envolve o sequenciamento de uma regio padro de DNA como uma

    ferramenta para a identificao de espcies. Lahaye et al., (2008), afirmam que

    DNA barcoding uma tcnica em que a identificao de espcies realizada

    usando sequncias de DNA a partir de um pequeno fragmento do genoma, com o

    objetivo de contribuir nos estudos ecolgicos e de conservao em que a

    identificao taxonmica tradicional seria invivel.

  • 17

    Figura 5. Regies mais utilizadas como DNA Barcoding em plantas Fonte modificada pela autora de:

    . Acesso em: 03 de nov. 2014.

    Para uma regio do gene se tornar um DNA barcoding foram definidos trs

    critrios: conter variabilidade gentica entre espcies em nvel significativo de

    divergncia, possuir locais de flancos conservados para o desenvolvimento de

    primers universais para PCR a fim de serem aplicados em estudos de taxonomia,

    alm de terem um comprimento de sequncia curta, para facilitar a extrao e

    amplificao do DNA (KRESS et al., 2008).

    O marcador barcoding, mais utilizado uma regio do gene citocromo c

    oxidase mitocondrial (COI ou cox1), muito empregado nos grupos de animais. O

    mesmo barcoding foi testado para as plantas terrestres, entretanto no

    demonstraram sucesso, a dificuldade est nas 300,000 espcies de plantas

    terrestres (HEBERT et al., 2003).

    Portanto, invivel sua utilizao em plantas principalmente as

    Angiospermas, devido a divergncias das regies codificantes do gene COI e por

    rapidamente terem a estrutura do seu genoma mitocondrial modificada, alm de

    http://losrelatosdesamid.blogspot.com.br/2013/05/mitocondriashtmlhttp://cmapspublic2.ihmc.us/rid=1N2FN04F7JMPKS2109/Recursos%20para%20organelas%20citoplasmaticoshttp://cmapspublic2.ihmc.us/rid=1N2FN04F7JMPKS2109/Recursos%20para%20organelas%20citoplasmaticos

  • 18

    apresentarem baixas taxas de substituio de bases no DNA mitocondrial,

    caractersticas que levaram a busca de regies barcoding alternativos, como as

    regies do DNA plastidial (KRESS et al., 2005; FAZEKAS et al., 2008; CBOL,

    2009).

    O Consortium for the Barcode of Life criado em 2004 com intuito de facilitar e

    formalizar a seleo de um cdigo de barras de plantas. Para isso realizou-se a

    formao de um grupo de trabalho com representantes de consrcios de diferentes

    grupos de pesquisa por parte da comunidade sistemtica que props, os sete

    principais marcadores barcoding candidatos, presentes no DNA de cloroplasto

    (HOLLINGSWORTH et al., 2011).

    O cloroplasto uma organela citoplasmtica, abundante nas clulas vegetais

    constitudo por apenas um cromossomo circular facilmente isolado (PALMER,

    1987). O genoma plastidial possui 120-160 kilo pares de bases (kpb) a estrutura

    geral representada por duas regies a Large Single Copy Region (LSC) e a Small

    Single Copy Region (SSC) interrompidas por duas copias de Large Inverted

    Reapets (IRa e IRb) (Figura 5). O genoma do cloroplasto contem todos os genes

    ribosomais (rRNA) e transportadores para a sntese das protenas fundamentais

    para seu funcionamento (SHINOZAKI et al., 1986).

    Geralmente, o cpDNA apresenta herana unipariental, sendo transmitido

    apenas pelo gameta feminino na maioria das angiospermas (DEMESURE et al.,

    1995). Alm disso, altamente conservado em termos de tamanho, contedo,

    estrutura e ordem dos genes (JUDD et al., 2002). Isso permite que iniciadores

    especficos desse genoma sejam utilizados em quase todo o reino vegetal,

    facilitando a comparao entre os diferentes txons.

    A recomendao de um cdigo de barras padro de plantas foi realizada pelo

    CBOL (2009), que comparou o desempenho das sete principais regies presentes

    no cpDNA, denominadas de matK, rbcL, rpoB, e rpoC1,ATPF-atpH, trnH-psbA, e

    psbK-psbI (KRESS et al., 2005; SHAW et al., 2007; TORCHOV e OLSON, 2007).

  • 19

    Figura 6. Esquema do Genoma do Cloroplasto. Fonte:. Acesso em 03 de nov.

    2014.

    .

    O gene matK codifica a protena maturase K, o gene rbcL codifica a

    subunidade grande da ribulose-1,5- bifosfato carboxilase/oxigenase, o gene rpoB

    codifica a subunidade da enzima RNA polimerase do cloroplasto, e o gene rpoC1

    codifica a subunidade da enzima RNA polimerase do cloroplasto. As regimer

    atpF-atpH, trnH-psbA e psbI-psbK so espaadores Intergnicos. Os genes atpF e

    atpH codificam as subunidades CFO I e CFO III da ATP sntase, respectivamente.

    Os genes psbK e psbI codificam dois polipeptdios de baixa massa molecular do

    fotossistema II; estas duas regies so altamente conservadas desde as algas at

    as plantas terrestres e parasitarias (LAHAYE et al., 2008, LOPES 2011). O gene

    trnH e um gene de tRNA e psbA codifica a proteina D1 do fotossistema II. Todos

  • 20

    estes dez genes so cloroplastidiais e localizam-se na regio Large Single Copy

    (LSC) do genoma do cloroplasto (LOPES, 2011).

    Aps a avaliao das propostas e inmeros trabalhos na busca barcoding em

    plantas o comit executivo da CBOL concluiu que s rbcL (marcador de taxa

    evolutiva lenta, porm conservada) e matK (mais varivel porm de maior

    resoluo) esto entre as regies de cdigo de barras aprovados para as plantas

    terrestres (CBOL, 2009).

    Portanto, o CBOL ao recomendar os genes rbcL e matK como o cdigo de

    barras para as plantas terrestres, considerou ser necessrio a introduo de novos

    dados para a caracterizao desses genes, assim como os progressos obtidos

    atravs dos primers do matK e rbcL.

    1.7.1 Maturase K

    O gene matK utilizado como um marcador na construo filogentica e tem

    mostrado alto poder de distino taxonmico tanto em nveis de ordem e famlia

    quanto em nveis de gnero e espcies de plantas, devido a sua rpida evoluo,

    presena em todas as plantas e elevado poder de discriminao entre espcies

    (HILU e LIANG, 1997).

    O gene matK tem aproximadamente 1500 pb est localizado dentro de um

    ntron classe II, entre os exons 5 e 3 do gene que codifica o trnK. (SUGITA et al.,

    1985; STEANE, 2005; DANIELL et al., 2006; TURMEL et al., 2006). Este gene de

    cpia nica contm altas taxas de substituio dentro da espcie e est emergindo

    como potencial candidato para estudos de sistemtica vegetal e evoluo. Desta

    forma, filogeneticamente, a taxa de evoluo do matK adequada para resolver

    relaes intergnero, bem como as relaes interespcies em muitas plantas

    angiospermas (HILU e LIANG, 1997) .

    O complexo gene matK - trnK comumente utilizado para estudos de

    evoluo de plantas e aborda a soluo para vrios nveis taxonmicos. O gene

    matK tem o tamanho ideal, elevada taxa de substituio, grande proporo da

    variao em nvel do cido nucleico, na primeira e segunda posio do cdon,

    baixo razo de transio/ transverso, e a presena de setores mutacionalmente

    conservadas (HILU e LIANG, 1997) .

    Para os estudos de barcoding o segmento utilizado de matK compreende em

    aproximadamente 790 pb (STOECKLE et al., 2011). Devido as caractersticas de

  • 21

    alto poder de discriminao e universalidade das espcies o CBOL recomendou

    como cdigo de barras de plantas o matK em combinao com rbcL (VIJAYAN e

    TSOU, 2010).

    1.7.2 rbcL

    Pela sua caracterstica a maior subunidade da ribulose-1,5-bifosfato

    carboxilase oxidase (RuBisCO ) desperta o interesse de engenheiros genticos e

    filogenistas de plantas, por ser um gene codificante de uma protena altamente

    conservada o rbcL. O stio ativo, que responsvel por quase toda a fixao de

    carbono na terra (KELLOGG e NICKOLAS, 1997) o gene mais comum utilizado

    para fornecer dados filogenticos.

    Este gene est localizado na regio Large Single Copy do cloroplasto, com

    aproximadamente 1.430 pares de bases, e apresenta uma taxa de evoluo lenta e

    bastante conservada, apresentando boa resoluo em nveis taxonmicos mais

    elevados, como famlia. Como a RuBisCo uma enzima fotossinttica muito

    importante, o rbcL foi o primeiro gene das plantas a ser sequenciado (ZURAWSKI et

    al., 1981). Este gene tem sido utilizado amplamente em estudos filogenticos de

    plantas com mais de 10000 sequncias do rbcL, j disponveis no GenBank

    (CHASE et al., 2007).

    2 OBJETIVOS

    Identificar os acessos de M. arundinacea por meio dos genes cloroplastidiais

    matK (maturase K) e o rbcL (ribulose-1,5-bifosfato carboxilase/oxigenase).

    Determinar a similaridade gentica entre os acessos de M. arundinacea

    (intraespecfica), por meio de marcadores RAPD.

  • 22

    REFERNCIAS BIBLIOGRFICAS

    AAGAARD, J. E.; VOLMER, S. S.; SORENSEN, F. C.; STRAUSS, S. H. Mitochondrial DNA products among RAPD profiles are frequent and strongly differentiated between races of Douglas-fir. Molecular Ecology, v.4, n.4, p.441-447, 1995. ANDERSSON L.. Revision of Maranta subgen. Maranta (Marantaceae). Nordic Journal of Botany,v. 6, n.6, p.729756, 1986. ANGEL, G.R., MAKESHKUMAR, T., MOHAN, C., VIMALA, B. and NAMBISAN, B. Genetic diversity analysis of starchy Curcuma species using RAPD markers. Journal of Plant Biochemistry and Biotechnology, v.17, n.2, p.173-176, 2008.

    ARNOLD, M. L.; BUCKNER, C. M. & ROBINSON, J. J. Pollenmediated introgression and hybrid speciation in Louisiana irises. Proceeding of the National Academy of Science of USA, v.88, n.4, p. 1398-1402, 1991. ARNS, Y.K.N. Estudo Taxonmico dos grupos Monotagma, Maranta e Myrosma (Marantaceae) em Pernambuco. 1997.105p. Dissertao de Mestrado Biologia Vegetal. Universidade Federal de Pernambuco, Pernambuco,1997. BENTLEY, R.; TRIMEN, H. Medicinal plants. London: J. and A. Churchill, 1880. v.4. p.228-306. BERNAL, H.Y.; CORREA, J.E. (eds.). Espcies vegetales promisorias de los paises Del convenio Andrs Bello. Bogot: Guadalupe, 1994. 547p. Tomo 10. (PREVECAB. Srie Cincia e Tecnologia, 53). BOUZAT, J. L. The population genetic structure of the Greater Rhea (Rhea Americana) in an agricultural landscape. Biological Conservation, v.99, n.3, p. 277-284, 2001. BRASIL. Ministrio da Agricultura, Pecuria e Abastecimento. Manual de hortalias no-convencionais / Ministrio da Agricultura, Pecuria e Abastecimento. Secretaria de Desenvolvimento Agropecurio e Cooperativismo. Braslia : Mapa/ACS, 2010. 92 p CBOL Plant Working Group. 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences, v.106, n.31, p.1279412797, 2009. CEREDA, M.P. Propriedades gerais do amido. So Paulo, Fundao Cargill, 89-100 p. (Srie: Culturas de Tuberosas Amilceas Latino-americanas, v. 1) 2002.

    CEREDA, M. P. Produo de fcula a partir do biri (Canna edulis).VILPOUX, O. (Org.) Tecnologia, uso e potencialidades de tuberosas amilceas

  • 23

    latinoamericanas. So Paulo: Fundao Cargill, 2003. 191-199 p. (Srie: Culturas de Tuberosas Amilceas Latinoamericanas, v.3). CEREDA, M. P. Massas alimentcias alternativas base de amido. VILPOUX, O. (Org.) Tecnologia, uso e potencialidades de tuberosas amilceas latinoamericanas. So Paulo: Fundao Cargill, 2003. 201-219 p. (Srie: Culturas de Tuberosas Amilceas Latinoamericanas, v.3).

    CHASE, M.W.; COWAN, R.S.; HOLLINGSWORTH, P.M.; BERG, C.; MADRINAN, S.; PETERSEN, G.;SEBERG, O.; JORGSENSEN, T.; CAMERO, K.M.; CARINE, M.; PEDERSEN, N.; HEDDERSON, T.A.J.;CONRAD, F.;SALAZAR, G.A.; RICHARDSON, J.E.;HOLLINGSWORTH, M.L.; BARRACLOUGH, T.G.; KELLY,L. ; WILKINSON, M. A proposal for a standardized protocol to barcode all land plants. Taxon 56, v.2, n.2, p. 295299, 2007.

    COELHO, I. da S; SANTOS, M. da C. F; ALMEIDA, D. L. de; SILVA, E. M. R. da; NEVES, M. C. P. Como plantar e usar a araruta. Braslia: Embrapa Informao Tecnolgica; Seropdica: Embrapa Agrobiologia, 2005. 55 p.

    COSTA, FLVIA R. C.; ESPINELLI, F. P.; FIGUEIREDO, F. O. G. Guia de marantceas da Reserva Ducke e da Reserva Biolgicado Uatum = Guide to the Marantaceae of the Reserva Ducke and Reserva Biolgica do Uatum, Manaus : INPA, 2008, 154p. DAEHLER, C. C.; STRONG, D. R. Hybridization between introduced smooth cordgrass (Spartina alterniflora; Poaceae) and native California cordgrass (S. foliosa) in San Francisco Bay. American Journal of Botany, v.84,n.5, p. 607-611, 1997. DANIELL, H.; LEE, S.B.; GREVICH, J.; SASKI, C.; QUESADAVARGAS, T.; GUDA, C.; TOMKINS, J.; JANSEN, R.K. Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theoretical and Applied Genetics, v.112, n.8, p. 15031518, 2006. DE GREEF, B.; TRIEST, L. The use of random amplified polymorphic DNA (RAPD) for hybrid detection in Scirpus from the river Schelde (Belgium). Molecular Ecology, v.8, n.3, p.379-386, 1999. DELGADO, H.S.; SIFUENTES, T.C. Plantas medicinales del Jardin Botnico IMETIPSS. Iquitos: Instituto Peruano de Seguridad Social/Instituto de Medicina Tradicional, 1995. 85p. DEMESURE, B.; SODZI, N.; PETITI, R.J. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology, v.4, n.1, p.129-131, 1995.

    http://link.springer.com/journal/122http://link.springer.com/journal/122

  • 24

    EBDA Empresa baiana de Desenvolvimento Agrcola S.A. Disponvel em: Acesso em : 03/11/2014. EISENSTEIN, B. I. The polymerase chain reaction: A new method of using molecular genetics for medical diagnosis. The New England Journal of Medicine, v.322, n. 3, p. 178-183, 1990. ERDMAN, M.D.; ERDMAN, B.A. Arrowroot (Maranta arundinacea): food, feed, fuel, and fiber resource. Economic Botany, v. 38, n.3, p. 322-341, 1984. FALEIRO, F. Marcadores moleculares aplicados a programas de conservao e uso de recursos genticos. Planaltina-DF: Embrapa Cerrados, 2007. 102 p.

    FARALDO, M.I.F. Marcadores moleculares em mandioca. In: CEREDA, M.P. Agricultura: Tuberosas Amilceas Latino Americano, So Paulo: Fundao Cargill, 2003. v.2, p.101-117. FAZEKAS, A.J.; BURGESS, K.S.; KESANAKURTI, P.R.; GRAHAM, S.W.; NEWMASTER, S.G.; HUSBAND, B.C.; PERCY, D.M.; HAJIBABAEI, M.; BARRETT, S. C. H. Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well. PLoS ONE. v. 3, n.7, p. e2802, 2008. FERREIRA, M. E.; GRATTAPAGLIA, D. Introduo ao uso de marcadores moleculares em anlise gentica. 3.ed. Braslia:EMBRAPA-CENARGEN, 1998. 220p. FRANCO, C. M. L. et al. Structural and functional characteristics of selected soft wheat starches. Cereal Chemistry, v. 79,n.2, p. 243-248, 2002. FRITSCH, P.; RIESEBERG, L. H. The use of Random Amplified Polymorphic DNA (RAPD) in conservation genetics. In: SMITH, T. B.; WAYNE, R. K. (Ed.). Molecular genetic approaches in conservation, New York: Oxford University Press, 1996, p. 54-73.

    FUKUDA, W. M. G.; CAVALCANTI J.; COSTA I.R.S. . Variabilidade gentica e melhoramento da mandioca (Manihot esculenta Crantz). Recursos Genticos e Melhoramento de Plantas para o Nordeste Brasileiro. 1994. Disponvel em: . Acesso: 03 de novembro de 2014. GLOBO RURAL. Araruta. Revista Globo Rural, v.11, n.131, p.56-59, 1996. GLOBO RURAL. Como plantar araruta. Revista Globo Rural, 2013. Disponvel em: http://revistagloborural.globo.com/vida-na -

  • 25

    fazenda/como_plantar/noticia/2013/12/como-plantar-araruta.html Acesso : 03 de novembro de 2014. GUILBOT, A., and MERCIER, C. Starch Pages. In: The Polysaccharides, Academic Press: Orlando, 1985. v. 3, p.209-292. GUIMARES, C. T.; MOREIRA, M. A. Gentica molecular aplicada ao melhoramento de plantas. In: BORM, A. Melhoramento de espcies cultivadas. Viosa: Editora UFV, 1999. p.715-740. HADRYS, H.; BALICK, M.; SCHIERWATER, B. Applications of Random amplified polymorphic DNA (RAPD) in molecular ecology. Molecular Ecology, v.1, n.1, p.55-64, 1992. HAMMEL, B.E. The vascular flora of La Selva Biological Station, Costa Rica. Marantaceae. Selbyana, Sorasota, v. 9, n.1, p.234242, oct.1986. HEBERT, P.D.N.; CYWINSKA, A.; BALL S.L.; DEWAARD, J.R. Biological identifications through DNA barcodes. The Royal Society, London, v. 270, n.1512, p.313-321, jan.2003. HERBERT, P.D.N; RATNASINGHAM, S.; DeWAARD J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. The Royal Society, v.270, n.1, p. 9699, 2003. HILU, K.W.; e LIANG H. The matK gene: sequence variation and application in plant systematics. American Journal of Botany, v.84, n.6, p. 830 839, 1997. HOLLINGSWORTH, P.M; GRAHAM, S.W; LITTLE, D.P. Choosing and Using aPlant DNA Barcode. PLoS ONE, v. 6, n.5, p. e19254, 2011. JAGGI,C.; WIRTH, T.; BAUR, B. Genetc variability in subpopulations of the asp viper (Vipera aspis) in the Swiss Jura Mountains: implications for a conservation strategy. Biological Conservation, v.94, n.1, p.69-77, 2000. JUDD, W. S.; CAMPBELL, C. S.; KELLOGG, E. A.; STEVENS, P. F. and DONOGHUE, M. J. Plant Systematics: a phylogenetic. Systematic Biology, v.53, n.3, p.517-518, 2002. KELLOGG, E. A. and NICKOLAS, D. J. The Structure and Function of Rubisco and their Implications for Systematic Studies. American Journal of Botany, v.84, n.3, p. 413428, 1997. KENNEDY, H. Systematics and pollination of the closedflowered species of Calathea (Marantaceae). University of California Publications in Botany, 1977. v.71, p.190. KENNEDY, H. New species of Calathea (Marantaceae) endemic to Costa Rica. Canadian Journal of Botany, v.75, n.8, p.1356-1362, 1997.

  • 26

    KENNEDY, H. Diversification in pollination mechanisms in the Marantaceae. In: Wilson, KL, Morrisson DA, (ed). Monocots Systematics and evolution. Melbourne: CSIRO, 2000, p.335343. KRESS, W.J.; ERICKSON, D.L. DNA barcodes: Genes, genomics, and bioinformatics. Proceedings of the National Academy of Sciences, v.105, n.8, p.27612762, 2008. KRESS, W. J.; WURDACK, K. J.; ZIMMER, E. A.; WEIGT, L. A.; JANZEN, D. H. Use of DNA barcodes to identify flowering plants. Proceedings of the National Academy of Sciences, v. 102, n.23, p.836974, 2005. KUEHN, M. M.; MINOR, J. E.; WHITE, B. N. An examination of hybridization between the cattail species Typha latifolia and Typha angustifolia using random amplified polymorphic DNA and chloroplast DNA markers. Molecular Ecology, v.8, n.12, p. 1981-1990, 1999. KUMALASARI, I. D.; HARMAYANI, E.; LESTARI, L. A.; RAHARJO, S.; ASMARA, W.; NISHI, K.; AND SUGAHARA, T. Evaluation of immunostimulatory effect of the arrowroot (Maranta arundinacea. L) in vitro and in vivo. Cytotechnology, v.64, n.2, p. 131137, 2012.

    KUMAR, P.; GUPTA, V.K.; MISRA, A.K.; MODI, D. R. and PANDEY, B. K. Potential of Molecular Markers in Plant Biotechnology. Plant Omics Journal v.2, n.4, p.141-162, 2009. LAHAYE, R.; van der BANK, M.; BOGARIN, D.; WARNER, J.; PUPULIN, F.; GIGOT, G.; MAURIN, O.; DUTHOIT, S.; BARRACLOUGH, T. G.; SAVOLAINEN, V. DNA Barcoding the floras of biodiversity hotspots. Proceedings of the National Academy of Sciences, v. 105, n. 8, p. 2923-2928, 2008. LEE, M. DNA markers and plant breeding programs. Advances in Agronomy, San Diego, v.55, p.265-343, 1995. LEN, J. Botnica de los cultivos tropicales. San Jose: IICA, 1987. 445p. LEONEL, M. Anlise da forma e tamanho de grnulos de amidos de diferentes fontes botnicas. Cincia e Tecnologia de Alimentos, Campinas, v. 27. n. 3. p. 579-588, 2007.

    LEONEL, M.; JACKEY, S.; CEREDA, M.P.. Processamento industrial de fcula de mandioca e batata doce - um estudo de caso. Cincia e Tecnologia de Alimentos, v. 18, n. 3, p.343-345,1998. LEONEL, M.; SARMENTO, S.B.S. Caractersticas dos rizomas e fcula de araruta (Maranta arundinacea) em diferentes estgios de desenvolvimento da planta. Brazilian Journal of Food Technology, v. 8, n.2, p. 93 - 98, 2004.

  • 27

    LINFANTE, Z. D.; AGUINAGALDE, I. The use of Random Amplified Polymorphic DNA (RAPD) markers for the study of taxonomical relationships among species of Asphodelus sect. Verinea (Asphodelaceae). American Journal of Botany, v. 83, n.7, p. 949-953, 1996. LOPES, S. M. M. de B. Botnica Molecular Forense: O DNA na identificao de espcies vegetais. 2011.43 f. Dissertao (Mestrado em Cincias Forenses) Unversidade do Porto, Portugal, 2011. MADINENI, M.,N.; FAIZA,S.; SUREKHA,R.,S.; RAVI,R.; AND GUHA, M. Morphological, Structural, and Functional Properties of Maranta (Maranta arundinacea L) Starch. Food Science Biotechnology, v. 21, n.3, p. 747-752, 2012. MARTINS, A. Q. Araruta. Revista da Flora Medicinal, v. 10, n.4, p.147-173, 1943. MARTINS, P. S. Dinmica evolutiva em roas de caboclos amaznicos. Estudos Avanados, v.19, n.53, p. 209-220, 2005.

    MATIOLI, S. R. (Org.). Biologia molecular e evoluo. 1. ed. Ribeiro Preto, SP: Holos, Editora, 2001. v. 1. 202 p. MEDINA, M.H; UCO, J.G.T.; GUERRERO,L.C.; ANCONA,D.B. Caracterizacin fisicoqumica de almidones de tubrculos cultivados en Yucatn, Mxico. Cincia e Tecnologia de Alimentos, v.28, n.3, p.718-726, 2008. MENEZES, C.C.E. et al. Anlise da pureza gentica e discriminao de cultvares de vinca (Catharanthus roseus(L.) G. Don) usando Randon Amplified Polymorphic DNA em DNA extrado de sementes e folhas. Revista Brasileira de Sementes, v. 24, n. 1, p. 279-285, 2002. MILACH S.C.K. Principais Tipos de Marcadores e suas Caractersticas. In: Milach, S. Marcadores Moleculares em Plantas. Porto Alegre: S. C. K. Milach, 1998, p. 17-28. MILLIKEN, W.; ALBERT, B. The use of medicinal plants by the Yanomami indians of Brazil. Part II. Economic Botany, v.51, n.3, p.264-278, 1997.

    MONTEIRO, D. A.; PERESSIN, V. A. Cultura da araruta. In:CEREDA, M. P. (Coord.). Agricultura: tuberosas amilceas Latino Americanas. So Paulo: Fundao Cargill, 2002, v. 2, p. 440-447. MORGANTE, M.; OLIVIERI, A.M. PCR-amplified microsatellites as markers in plant genetic. The Plant Journal, v.3, n.1, p.175-182, 1993. MULLIS, K. B.; FALOONA, F. Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction. Methods in Enzymology, v. 155, n.C, p. 335-350, 1987.

  • 28

    NASS, L.L. Utilizao de recursos genticos vegetais no melhoramento. In: NASS,L.L.; VALOIS, A.C.C.; VALADARES- INGLIS, M.C.(Ed.). Recursos genticos e melhoramento, 2001. Porto Alegre: Grfica Editora Pallotti, Fundao de Apoio Pesquisa de Mato Grosso, Cap.2, p 29-55. NEVES, M. C. P.; COELHO, I. S.; ALMEIDA, D. L. Araruta; resgate de um cultivo tradicional. Rio de Janeiro: Seropdica RJ: EMBRAPA, 2005, 4p (Seropdica RJ: EMBRAPA Comunicado tcnico 79). PALMER, J.D .Chloroplast DNA evolution and biosystematic uses of chloroplast DNA variation. The American Naturalist, v.130,n.1-2, p.629, 1987. PECKOLT, T.; PECKOLT, G. Histria das plantas medicinais e teis do Brazil. Rio de Janeiro: Laemmert e C, 1893. (5 fascculo).

    PINHEIRO, J. B.; ZUCCHI, M. I.; TELES, F. L.; ZARA, N. A.Molecular genetic diversity in accesses of saffron using RAPD markers. Acta Scientiarum - Agronomy, v. 25, n. 1, p. 195-199, 2003.

    PIO CORRA, M. Dicionrio das plantas teis do Brasil e das exticas cultivadas. Rio de Janeiro: Imprensa Nacional, 1984. v. 1. p. 150-151, 309. Editado pelo Servio de Informao Agrcola.

    PURSEGLOVE, J.W. Tropical crops: monocotyledons.England: Longman Group Limited, 1985. REVILLA, J. Plantas teis da Bacia Amaznica. Manaus: INPA/SEBRAE, 2002. v.1. ROUT, G.R.; SENAPATI, S.K. and APARAJITA, S. Studies on the genetic relationship among 13 cultivars of Calathea (Marantaceae) using RAPD and ISSR markers. Advances in Horticultural Science, v. 21, n. 3, p. 147-155, 2007.

    SHAW, J.; LICKEY, E.B.; SCHILLING, E.E.; SMALL, R.L. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany, v. 94, n.3, p.275288, 2007. SCHEINERT, P.; BEHRENS, B.; KAHLE, D. Optimizing DNA Amplification Protocols using the Eppendorf Mastercycler. Eppendorf North America, Apr. 8. 2003. Disponvel em:

  • 29

    TAKAIWA, F.; KATO, A.; TOHDOH, N.; SHIMADA, H. e SUGIURA, M. The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression. EMBO J, v. 5, n.9, p. 20432049, 1986. SILVA, J.R. da, ASSUMPO, R., VEGRO, C.L.R. A insero da fcula de mandioca no mercado de amido. Informaes econmicas, v.30, n.7, p.31-41, jul.2000. SILVA, J. R. S.; MONTEIRO, D. A. Cultura da araruta industrial. O Agronmico, Campinas, v. 20, n. 11/12, p. 11- 21,1968. SOUZA, V. C.; LORENZI, H. Botnica Sistemtica: guia ilustrado para identificao das famlias de Angiospermas da flora brasileira, baseado em APG II. Nova Odessa, Instituto Plantarum, 2005. 640p. STEANE*, D. A.; JONES, R. C. and VAILLANCOURT, R. E. A set of chloroplast microsatellite primers for Eucalyptus (Myrtaceae). Molecular Ecology, V. 5, n.3, p. 538541, 2005. STOECKLE, M.Y.; GAMBLE, C.C.; KIRPEKAR, R.; YOUNG,G.;AHMED, S.; LITTLE, D.P. Commercial teas highlight plant DNA barcoding successes and challenges. Scientific Reports, v. 1, p. n.42, p.7, 2011. TORCHOV, H.; OLSON, M.S. The architecture of the chloroplast trnH-psbA noncoding region in angiosperms. Plant Systematics Evolution, v. 268, n.1-4, p. 235-256, 2007. SUGITA, M.; SHINOZAKI, K.; SUGIURA, M. Tobacco chloroplast tRNALys (UUU) gene contains a 2.5-kilobase-pair intron: an open reading frame and a conserved boundary sequence in the intron. Proceedings of the National Academy of Sciences, v.82, n.11, p.35573561, 1985. TAYLOR, C. et al. Determination of the order of substrate addition to MspI DNA methyltransferase using a novel mechanism-based inhibitor. The Biochemical Journal, v. 291, n.2, p. 493504, 1993. TINGEY, S.V.; RAFALSKI, J.A. & WILLIAMS, J.G.K. Genetic analysis with rapd markers. in: SYMPOSIUM ON APPLICATIONS OF RAPD TECHNOLOGY TO PLANT BREEDING, 1, 1992. Anais. Minneapolis: Crop Science Society of America/American society for horticultural Science/American genetic association, 1992. p. 3-8. TURMEL, M., OTIS, C. and LEMIEUX, C. 2006. The chloroplast genome sequence of Chara vulgaris sheds new light into the closest green algal relatives of land plants. Molecular Biololy and Evoution,.v.23, n.6, p.1324-1338, 2006. VIJAYAN, K.; e TSOU CH. DNA barcoding in plants: taxonomy in a new perspective. Current Science, v.99, n.11 p. 1530-1541, 2010.

    http://onlinelibrary.wiley.com/doi/10.1111/men.2005.5.issue-3/issuetoc

  • 30

    VOS, P.; HOGERS, R.; BLEEKER, M.; REIJANS, M.; van de LEE, T.; HORNES, M.; FRIJTERS, A.; POT, J.; PELEMAN, J.; KUIPER, M.; ZABEAU, M. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research, v.23, n.21, p.4.407-4.414, 1995. WEEDEN, N.F. Inheritance and reliability of RAPD markers. In: SYMPOSIUM ON APPLICATIONS OF RAPD TECHNOLOGY TO PLANT BREEDING, 1.,1992, Minneapolis. Anais. Minneapolis: Crop Science Society of America/American Society for Horticultural Science/American Genetic Association, 1992. p. 12. WEISHING, K.; NYBOM, H.; WOLFF, K. and MEYER, W. DNA isolation and purification. In: DNA Fingerprinting in Plants and Fungi, CRC Press, 1995 p. 4459. WHISTLER, R. L., TURNER, E. S. Fine structure of starch granule sections. Journal Polymer Science, v. 18, p. 153-156, 1955.

    WILLIAMS, J.G.K.; KUBELIK, A.R.; LIAK, K.J.; RAFALSKI, J.A.; TINGEY, S.V. DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, v.18, n.22, p.6531-6535, 1990. WOLFF, K. ; MORGAN-RICHARDS, M. PCR markers distinguish Plantago major subspecies. Theoretical and Applied Genetics, v.96,n.2, p.282-286, 1998. ZHAO, J.; WISTLER, R. L. Spherical aggregates of starch granules as flavor carriers. Food Technology, v. 48, n. 7, p. 104-105, 1994. ZURAWSKI, G.; PERROT, B.; BOTTOMLEY, W.; WHITEFIELD, P.R. The structure of the gene for the large subunit of ribulose-1,5 -bisphosphate carboxylase from spinach chloroplast DNA. Nucleic Acids Research, v. 9, n.14, p. 32513270, 1981.

  • 31

    CAPTULO I: Caracterizao dos genes matK e rbcL e da

    variabilidade gentica entre os acessos de Araruta (Maranta

    arundinacea L.).

  • 32

    Caracterizao dos genes matK e rbcL e da variabilidade gentica

    entre os acessos de Araruta (Maranta arundinacea L.).1

    1 Parte da dissertao de mestrado da primeira autora

    Ingrid Batista Pinto2; Carina Elisei de Oliveira 3 .

    2 Aluna do mestrado em Biotecnologia da UCDB;

    3 Professora Dra. responsvel pelo laboratrio de Biologia Molecular da UCDB;

    .

    Autor para correspondncia: ingridbatistabiotec@gmail.com;

  • 33

    INTRODUO

    A famlia Marantaceae um grande grupo de plantas da ordem Zingiberales

    (NEVES et al., 2005), apresenta distribuio de forma pantropical, so plantas

    tpicas de florestas midas tropicais, crescendo principalmente em margens de rios

    e clareiras, so compostas por 530 espcies e 31 gneros (KENNEDY, 1977;

    ANDERSSON, 1986; KENNEDY,1997, 2000). De acordo com Souza e Lorenzi,

    2005 o Brasil, possui 150 espcies, o gnero mais representativo no pas

    Calathea e Maranta.

    Os representantes desta famlia so utilizadas como plantas ornamentais e

    algumas espcies so utilizados na alimentao humana tais como Maranta

    arundinacea L. e Calathea allouia Lindl, (ARNS, 1997).

    Maranta um gnero exclusivamente neotropical com 34 espcies

    distribudas em toda a Amrica Central e do Sul, mas com a maioria das espcies

    concentrada na mata Atlntica, floresta Amaznica brasileira e no cerrado (VIEIRA e

    SOUZA, 2008).

    A araruta (Maranta arundinacea L.) uma planta herbcea, com caule

    articulado de 1,20 m de altura, rizoma fuziforme, casca brilhante, com escamas e

    produzido em tufos aderentes aos rizomas (MONTEIRO e PERESSIN, 2002). Sua

    principal importncia esta relacionada s caractersticas do seu amido, o qual

    confere leveza e alta digestibilidade aos confeitos (NEVES et al., 2005).

    Devido produo industrial de outras fontes de amido, tais como mandioca,

    milho, aveia, cevada e trigo, o cultivo da araruta foi sendo gradativamente

    substitudo, chegando a quase extino, sendo de grande importncia a

    caracterizao de seu material gentico atravs de marcadores moleculares, como

    meio de preservao e conservao da sua diversidade e populaes (FARALDO et

    al., 2003, NASS, 2001).

    Uma das tcnicas utilizadas atualmente para a identificao de espcies

    baseada na tcnica de DNA barcoding a qual realizada usando sequncias de DNA

    a partir de um pequeno fragmento do genoma, com o objetivo de contribuir para

    uma ampla gama de estudos ecolgicos e de conservao em que identificao

    taxonmica tradicional no vivel (LAHAYE et al., 2008). Sete principais regies

    do DNA do cloroplasto foram analisadas como potencial barcoding, mais somente o

  • 34

    gene rbcL e matK esto entre as regies de cdigo de barras aprovados para as

    plantas terrestres, segundo o CBOL (Consortium for the Barcode of Life).

    A caracterizao morfolgica dos acessos de plantas visa basicamente

    diferenciao fenotpica entre os acessos, contribuindo para reduzirem as

    duplicaes. A caracterizao e avaliao do germoplasma de algumas plantas so

    fundamentais para a sua utilizao mais eficiente nos trabalhos de melhoramento.

    (FUKUDA et al., 1994).

    Tcnicas envolvendo marcadores moleculares permitem compreender e

    organizar a variabilidade gentica de um programa de melhoramento, acessando

    variabilidade de DNA, que no influenciado pelo ambiente como so, por exemplo,

    os caracteres morfolgicos e fenotpicos em geral de uma planta. Entre as tcnicas

    disponveis, os marcadores RAPD (WILLIAMS et al., 1990), so utilizados por

    alguns pesquisadores envolvidos no desenvolvimento de mtodos de identificao

    de cultivares (WEEDEN, 1992; MENEZES et al., 2002), principalmente por ser uma

    tcnica simples que no requer nenhuma informao prvia sobre sequncias de

    nucleotdeos do genoma da espcie. Alm disso bastante acessvel e de custo

    relativamente baixo que pode ser utilizada em organismos cujas informaes

    moleculares ainda so escassas.

    Diante do exposto, este trabalho teve como objetivo identificar os acessos de

    M. arundinacea atravs dos genes cloroplastidiais matK (maturase K) e o rbcL

    (ribulose-1,5-bifosfato carboxilase/oxigenase), assim como determinar a

    variabilidade gentica entre os acessos de M. arundinacea (intraespecfica), por

    meio de marcadores RAPD.

    MATERIAL E MTODOS

    AMOSTRAS

    Obteno das amostras

    As amostras foram obtidas de plantas matrizes de M. arundinacea do acesso

    denominado de Comum (adquirido do Centro de Tecnologia e Estudos do

    Agronegcio da UCDB- CeTeAgro) e os rizomas dos acessos denominados de SC ,

    Guadalupe e Seta adquiridos de banco de germoplasma CERNAGEM EMBRAPA

    Braslia e cultivados no CeTeAgro (Figura 1). Os acessos foram cultivados em

  • 35

    vasos no ptio lateral da casa de vegetao do CeTeAgro e posteriormente as

    folhas foram coletadas para as anlises.

    Figura 1. Imagens dos quatro acessos da M. arundinacea. A) Acesso Comum-CeTeAgro, B) Acesso SC- CERNAGEM EMBRAPA Braslia, C) Acesso Guadalupe- CERNAGEM EMBRAPA Braslia, D) Acesso Seta- CERNAGEM EMBRAPA Braslia.

    AVALIACO DO PERFIL GENTICO

    Para a anlise molecular foram coletadas com aproximadamente trs meses

    de cultivo 10 folhas jovens, de cada acesso. O material colhido foi lavado com

    hipoclorito e lcool 70%, e enxaguados com gua destilada. Acondicionados em

    placas de Petri e secos com toalha de papel esterilizada. Com auxlio de um pistilo

    esterilizado, as folhas foram maceradas em cadinho de porcelana separadamente

    com nitrognio lquido, e transferidos para tubo tipo falcon de 50 mL e

    imediatamente, acondicionados em ultrafreezer 80C.

    EXTRAO DO MATERIAL GENTICO

    A extrao de DNA foi realizada a partir de folhas de acordo com Saghai-

    Maroof et al. (1984), otimizado para extrao de DNA de araruta.

  • 36

    Aproximadamente, 10g de tecido foliar fresco, macerado com nitrognio

    lquido, e ressuspendidas em 10 mL de tampo de extrao CTAB 1% (70 M de

    NaCl; 50 M de EDTA pH 8,0; 100 M Tris-HCl pH 7,5; 1% de p/v de CTAB; 1% de

    p/v de polivinil pyrrolidone, 140 l de - mercaptoetanol e gua destilada

    deionizada). A seguir, as amostras foram incubadas em banho-maria a 65C por

    aproximadamente 60 minutos, agitadas levemente a cada cinco minutos. Aps foi

    adicionado 15 mL de fenol/clorofrmio (1:1), invertendo os tubos. Transferindo o

    sobrenadante para tubos novos e o procedimento foi repetido mais uma vez. Em

    seguida, foram adicionados 15 mL de clorofrmio/lcool isoamlico (CIA) na

    proporo de 24:1 (v:v), efetuando-se a inverso dos tubos seguida de

    centrifugao 3400xg por 10 minutos. O sobrenadante foi coletado e transferido

    para tubos novos e adicionado 20mL de isopropanol absoluto (v:v) a 20C,

    promovendo a precipitao do DNA, o qual foi centrifugado, retirado o

    sobrenadante, permanecendo o pellet. Aps o DNA foi ressuspendido em 13mL de

    TE (10 mM de Tris-HCl pH 8,0 e 1 mM de EDTA). Para precipitar o DNA foi

    adicionado 0,5mL de NaCl 5M e 20 mL de etanol absoluto.Os tubos foram invertidos

    e centrifugados. Em seguida foi acrescentado 10 ml de etanol 70% a 20C,

    promovendo a lavagem do DNA, seco ao ar, e suspender novamente em 1mL de

    tampo TE, adicionando 120 L de RNAse (4 mg/mL), incubando a 37C por

    30minutos. Em seguida, a suspenso de DNA foi armazenada a 20C at o

    momento do uso.

    A concentrao do DNA foi estimada atravs de Biofotmetro (Eppendorff). A

    integridade do DNA foi avaliada por eletroforese em gel de agarose 0,8 % em

    tampo TBE 1x (89mM de Tris-base; 89mM de cido brico; 2 mM de EDTA pH 8,0

    e gua destilada e deionizada at completar o volume de 100 mL). Para a

    visualizao do DNA, o gel foi corado com brometo de etdio na proporo de 0,5

    g/mL de gel. Aps a eletroforese, foi fotografado sob luz UV em sistema digital

    L.Pix Image (Loccus Biotechnology).

    VERIFICACO DA QUANTIDADE E QUALIDADE DO DNA

    A concentrao e pureza do DNA foram avaliadas atravs de

    espectrofotmetro (modelo Epperdorf AG 2231 Homburg, Bio Photometer) pela

    leitura de absorbncia a 260nm e a 280nm, razo das leituras A260/ A280. Para cada

    amostra foram realizadas trs leituras e consideradas as mdias.

  • 37

    DESENHO DE PRIMERS (INICIADORES) DOS GENES MATK E RBCL

    Nas anlises de (PCR), foram utilizados quatro primers desenhados,

    utilizando o Custom Primers - OligoPerfect Designer da Invitrogem, balizados nas

    sequncias depositadas no GenBank ( Tabela 1).

    PCR CONVENCIONAL

    As reaes de polimerase em cadeia (PCR) foram preparadas em volume de

    50 L contendo, tampo de PCR 1X, 1,65mM MgCl2, 0,1mM de cada dNTP, 20pM

    de primer, 100ng de DNA genmico e 1U de TaqDNA polimerase (Invitrogen). A

    amplificao foi realizada em termociclador PTC-100 (MJ Research) programado

    como se segue: desnaturao inicial de 5min a 94C, 35 ciclos de 1min a 94C, 1

    min a 50C e 1min a 72C, com extenso final de 10min a 72C, resfriamento a 4C.

    Os produtos da PCR foram analisados em gel de agarose 2,0% e corados com

    brometo de etdio a 0,5 g/mL. A eletroforese foi realizada em cuba horizontal (Bio

    Rad) com tampo TBE 1X. As amostras foram submetidas eletroforese a 100

    Volts por duas horas, atravs de fonte Power Pac HV (Bio Rad). O gel foi

    fotografado sob luz UV em sistema digital L.Pix Image (Loccus Biotechnology). Aps

    o mtodo de PCR as amostras foram purificadas, quantificadas, seguido de

    sequenciamento. Ambas as cadeias de DNA foram geradas em um sequenciador

    automatizado UP TO 950pb (Applied Biosystems Inc., Foster City, CA, EUA), e o

    alinhamento foi determinado manualmente por meio do software BioEdit v.7.2.5

    (HALL, 1999). As sequncias obtidas foram comparadas nos bancos de dados

    internacionais como o BOLD System do International Barcode of Life, e Genbank.

    Tabela 1. Genes utilizados, primers e os nmeros de acesso no GenBank

    Primer Sequncia 5 3 GenBank Regio de

    Amplificao

    rbcL forward AGTGTTGGATTTAAAGCTGGTGTT JQ592613.1 1-24

    rbcL reverse TGGTTTAATAGTACATCCCAATAGGG JQ592613.1 503-476

    matK forward GATCACGGTTTAACTAGTTCGATTTT JQ341325.1 100-125

    matK reverse CTTGTTGCAATAGAAGAAAACCC JQ341325.1 1800-1778

  • 38

    ANLISE DAS SEQUNCIAS DOS GENES MATK E RBCL

    Para se analisar acessos desconhecidos molecularmente, duas metodologias

    foram propostas por Hebert et al.(2003). A primeira Kimura 2- parmetros ou

    K2P(KIMURA, 1980), sendo as rvores construdas utilizando Neighbor-Joining

    (SAITOU N. e NEI M., 1987). A segunda a utilizao de busca nos bancos de

    dados BLAST e BOLD Systems.

    As sequncias forward e reverse de cada par de primer foram feitas em

    duplicata, editadas, e manualmente selecionado para eliminao de sequncias de

    baixa qualidade. e convertidas em formato FASTA no programa BioEdit (HALL,

    1999). Alinhamentos mltiplos das sequncias foram realizados atravs do software

    Jalview (WATERHOUSE, 2009).

    As sequncias alinhadas foram analisadas atravs, da busca BLAST

    (blast.ncbi.nlm.nih.gov/Blast.cgi) e BOLD Systems (www.barcodinglife.com), onde

    um algoritmo procura trechos de similaridade local entre as sequncias amostradas

    e os resultados podem ser visualizados em ordem decrescente, das espcies j

    identificadas, onde foi possvel a comparao dos gentipos das plantas usadas

    neste trabalho.

    O modelo de substituio de nucleotdeos estabelecido para quantificar a

    divergncia entre indivduos o K2P, pois o modelo mais indicado quando as

    distncias genticas so pequenas (NEI e KUMAR, 2000). Os padres de

    divergncia sugeridos pelas distncias intra e interespecficas foram graficamente

    representados usando um dendrograma de Neighbor-Joining (NJ) com 1000

    rplicas de bootstrap. As anlises foram realizadas utilizando o programa MEGA 6

    (TAMURA et al. 2013).

    MARCADORES RAPD

    Para as anlises de diversidade gentica, entre os acessos foi utilizado o

    marcador molecular RAPD (Polimorfismos de DNA amplificados ao acaso), que se

    baseia na amplificao arbitrria simultnea de fragmentos de DNA. Os 25 primers

    utilizados e as suas respectivas sequncias esto descritos na Tabela 2.

  • 39

    Tabela 2. Lista dos primers utilizados com suas respectivas sequncias de bases.

    Primer Sequncia 5 3 Primer Sequncia 5 3

    OP 81 GGA GCG TAC T OPC 08 TGG ACC GGT G

    OP 93 GTG CCG CACT OPD 01 ACC GCG AAG G

    OP 95 GTG ACC AGA G OPD 08 GTG TGC CCC A

    OPA 01 CAG GCC CTT C OPE 03 CCA GAT GCA C

    OPA 02 TGC CGA GCT G OPE 06 AAG ACC CCT C

    OPA 04 AAT CGG GCT G OPF 05 CCG AAT TCC C

    OPA 05 AGG GGT CTT G OPM 05 GGG AAC GTG T

    OPA 07 GAA ACG GGT G OPP 14 CCA GCC GAA C

    OPA 17 GAC CGC TTG T OPAB 01 CCG TCG GTA G

    OPA 18 AGG TGA CCG T OPAF 05 CCC GAT CAG A

    OPA 20 GTT GCG ATC C OPAL 03 CCC ACC CTT G

    OPC 04 CCG CAT CTA C OPBA 02 TGC TCGGCT C

    OPC 07 GTC CCG ACG A - -

    As reaes de polimerase em cadeia (PCR) foram preparadas em volume de

    25 L contendo tampo de PCR 1X, 3mM MgCl2, 0,1mM de cada dNTP, 0,2M

    de primer, 30ng de DNA genmico e 1U/uL de TaqDNA polimerase (Invitrogen). A

    amplificao foi realizada em termociclador PTC-100 (MJ Research) programado

    como se segue: desnaturao inicial de 5min a 94C, seguido de 40 ciclos de 1min a

    92C, 1min e 30 sec. a 37C, 1min e 30 sec. a 72C, com extenso final de 6min a

    72C. Os produtos amplificados foram analisados em gel de agarose 1,0%. A

    eletroforese foi realizada em cuba horizontal (Bio Rad) com tampo TBE 1X a 100

    Volts por duas horas, atravs de fonte Power Pac HV (Bio Rad). O gel foi corado

    com brometo de etdio e foto documentado em grafado sob luz UV em sistema

    digital L.Pix Image (Loccus Biotechnology).

    Todas as etapas de preparao dos reagentes foram realizadas em capela

    especfica para PCR com prvia utilizao de luz ultravioleta durante 15 minutos.

    ANLISE DOS DADOS OBTIDOS ATRAVS DE MARCADORES RAPD

    Com os gis obtidos gerou-se uma matriz binria em que os acessos foram

    genotipados quanto presena (1) e ausncia (0) de bandas, com a matriz binria

  • 40

    calculou-se a porcentagem de polimorfismo de cada primer utilizado atravs da

    frmula:

    P = nbt

    nbp

    Sendo que:

    P= porcentagem de polimorfismo (ou taxa de polimorfismo);

    nbp=nmero de bandas polimrficas;

    nbt=nmero de bandas total.

    Com matriz binria calculou-se tambm o coeficiente de similaridade de

    Jaccard entre todos os acessos conforme a formula abaixo:

    Sij= a

    a+b+c

    Sendo que:

    a = nmero de casos em que ocorre a presena da banda em os ambos acessos,

    simultaneamente;

    b = nmero de casos em que ocorre a presena da banda somente no indivduo i;

    c = nmero de casos em que ocorre a presena da banda somente no indivduo j.

    A anlise de agrupamento foi realizada pelo mtodo UPGMA (Unweighted

    Pair-group Method with Arithmetical Average. Todas as anlises foram rodadas no

    programa R Studio, verso 0.98.1091.

    RESULTADOS E DISCUSSO

    O DNA extrado foi avaliado por eletroforese em gel de agarose,

    demonstrando que o protocolo segundo Saghai-Marrof et al. (1984), utilizado nesta

    pesquisa possibilitou a obteno de um DNA genmico de boa quantidade e

    qualidade. Isso foi possvel devido quantidade de reagentes (EDTA, PVP, 2-

    Mercaptoetanol), que inibem a degradao do material genmico, inativando

    enzimas especficas ou compostos secundrios, promovendo a quelao de ctions

  • 41

    divalentes, tais como Mg2+ e Ca2+, mantendo o pH do tampo estvel (Tris-HCl) e a

    desproteinizao gerada por diversos reagentes orgnicos utilizados nas etapas da

    extrao (Fenol, Clorofrmio, Alcool Isoamlico, Isopropanol), assim como a retirada

    de RNA da amostra atravs do uso de RNAse (BONATO et al., 2002).

    A utilizao de todos os reagentes combinados em etapas determinadas da

    extrao, assim como a utilizao do CTAB (Cationic hexadecyl trimethyl

    ammonium bromide ou brometo de cetiltrimetilamnio), que faz com que

    polissacardeos e cidos nucleicos possuam solubilidade diferenciada na presena

    desse detergente, inibindo a ao de complexos polifenlicos que, segundo Couch

    & Fritz (1990), aderem irreversivelmente ao DNA, inibindo a ao das DNA

    polimerase e das endonucleases de restrio.

    Os dados de quantificao do material gentico dos quatro acessos

    avaliados via espectrofotometria variou de 1,91 a 1,94 apresentando-se dentro dos

    parmetros desejados (Tabela 3). Segundo Barbosa (1998), um DNA puro tem

    OD260/OD280 de 1,8 a 2,0 e uma razo menor que 1,8 indica possvel

    contaminao das amostras com protenas e/ou outras substncias em grande

    quantidade na amostra, enquanto a razo maior que 2,0 indica que as amostras

    devem estar contaminadas com compostos orgnicos.

    Tabela 3. Dados de quantificao via espectrofotometria das extraes de material gentico foliar de quatro acessos de araruta. A absorbncia (Abs) foi medida no comprimento de onda de 260 a 280 nanmetros

    Acesso Concentrao

    ng/L

    Qualidade

    Abs: 260/280

    Araruta Comum 3366 1.94

    Araruta Seta 1961 1.91

    Araruta Guadalupe 1375 1.94

    Araruta SC 1936 1.92

    A extrao de DNA apenas uma etapa que precede as tcnicas aplicadas

    PCR, como a RAPD. A aplicao de um material gentico de boa qualidade

    empregado na tcnica de PCR diminui as chances de alteraes de resultados ou

    inibio da mesma, ocasionado por algum contaminante que no tenha sido

    removido no momento da extrao.

  • 42

    As amplificaes do gene matK e rbcL dos diferentes acesso de araruta

    geraram fragmentos de 2000 pb e 500pb respectivamente, e no foi possvel

    verificar variao nos padres de bandas amplificados entre os acessos.

    Os produtos amplificados foram sequenciados em ambas as direes e estes

    foram alinhados. As sequncias e os fragmentos com baixa qualidade foram

    eliminados manualmente, objetivando minimizar os erros.

    O sequenciamento do gene matK, de todos os acessos estudados, produziu

    sequncias muito pequenas, e o acesso Seta foi excludo devido a m qualidade da

    mesma. A falha de amplificao por PCR do matK em alguns grupos taxonmicos

    foi relatada em alguns estudos, pois os iniciadores projetados dentro da regio de

    matK podem ser problemticos para a amplificao de PCR e sequenciamento,

    devido a ampla variabilidade na regio do matK, o que leva concepo de novos

    primers taxon-especficos ou modificaes dos iniciadores existentes (WOLF et al.,

    1987; YU, et al., 2011). No entanto as sequncias do gene matK, foram as que

    obtiveram desempenho menos satisfatrio no sequenciamento.

    O matK bastante til em reconstrues filogenticas em nveis taxonmicos

    como a ordem ou a famlia, mas tem sido utilizado igualmente em nveis, como o

    gnero ou a espcie (CHASE et al., 2007; LAHAYE et al., 2008), porm, por serem

    muito similares, no houve distino em nenhum dos nveis taxonmicos citados

    acima para os acessos de Maranta arundinacea.

    A regio amplificada correspondente ao gene matK dos quatro acessos

    (Comum, SC, Guadalupe e Seta), obteve-se um valor mximo de identidade de

    99,66%, quando submetidas no programa, BOLD Systems. Houve uma diferena

    quando a comparao ocorreu atravs do BLAST, onde as sequncias deram um

    valor de 100% de identidade entre os acessos. Estes resultados s confirmam que

    os quatro acessos testados todos so da espcie M. arundinacea.

    J as sequncias do gene rbcL, apresentaram boa qualidade no

    sequenciamento. Os acessos Comum e JQ592613.1 (Genbank), apresentaram

    maior similaridade entre si, diferenciando-se igualmente dos acessos SC,

    Guadalupe e Seta. A partir do alinhamento das sequncias foi possvel gerar um

    dendograma (Figura 2), possibilitando a construo de um grupo com subgrupo e o

    outgroup. O subgrupo constitudo pelos acessos Comum e rbcL (JQ592613.1) de

    M. arundinacea o valor de bootstrap, do ramo ficou em 89%, considerado

    aceitvel em relao a medida de confiabilidade dos ramos gerados pelas anlises

  • 43

    filogenticas, que estima o grau de suporte de cada ramo entre os acessos.

    Entretanto, o ramo constitudo pelos acessos SC, Guadalupe, Seta e rcbL

    (3845927560) de M.arundinacea, retirado do GenbanK, por serem muito similares,

    obtiveram valores < 50%, pois o bootstrap analisa a partir da criao de vrios

    conjuntos de sequncias nas quais so escolhidas randomicamente colunas do

    alinhamento mltiplo e so geradas novas anlises para cada um dos novos

    conjuntos gerados (LEPAGE,1992).

    As diferenas de similaridade encontradas, neste estudo, provavelmente so

    relacionadas, distribuio geogrfica dos diferentes acessos, ocorrendo

    possivelmente alteraes nas frequncias allicas adaptadas para as condies

    ambientais ou simplesmente deriva gentica.

    Segundo Soltis e Soltis (1998), a maioria dos estudos filogenticos sugere

    que o gene rbcL o mais adequado para reconstruir as relaes em nvel de gnero

    entretanto, pouco utilizado em nveis especficos. Observou-se neste trabalho que a

    regio do gene rbcL foi facilmente amplificada e sequenciada para os acessos de M.

    arundinacea, apresentando valores mximos de identidade e poder de

    discriminao interespecfico satisfatrios.

    Comparando - se o acesso Comum de M. arundinacea com as demais,

    ocorreu diferena apenas por algumas regies que apresentaram nucleotdeos

    divergentes (Apndice 1). O achado pode ajudar pesquisadores a distinguir plantas

    distintas, mas que aparentemente paream estar relacionadas entre si.

    As sequncias obtidas do gene rbcL, foram analisadas e comparadas com

    as sequncias depositadas nos bancos de dados do BOLD Systems (Apndice 1) e

    os resultados apresentaram 100% de identidade dos quatro acessos testados. O

    mesmo aconteceu quando as sequncias foram submetidas busca na base de

    dados genmica BLAST. A regio do gene matK, apesar do sequenciamento menos

    satisfatrio, apresentou valores de identidade atravs da busca BOLD Systems e

    BLAST similares ao gene rcbL, ambos comprovam que os acessos so da espcie

    M. arundinacea.

  • 44

    Figura 2. Dendograma do gene rcbL, obtido a partir da anlise de Neighbor-joining(NJ) ,dos acessos Comum, Seta, SC , Guadalupe, Siphonochilus decorus, foi usado como outgroup. Os valores encontrados nos ramos indicam os valores de bootstrap (>50) baseado em 1.000 interaes.

    VARIABILIDADE GENTICA

    Para avaliar a variabilidade gentica dos diferentes acessos utilizou-se 25

    primers, dos quais oito no amplificaram e 11 geraram quantidade igual ou inferior

    de quatro bandas, representando 76% dos primers avaliados. Dos 17 primers que

    geraram polimorfismo seis foram selecionados por apresentarem qualidade na

    amplificao e maior polimorfismo, dos quais destaca-se o OPA02 (Tabela 4). Os

    primers selecionados produziram 57 bandas, sendo 28 polimrficas, o que

    representa 49,12% de polimorfismo. Em mdia, cada primer amplificou 9,5 bandas

    polimrficas.

    Tabela 4. Lista dos primers e suas respectivas sequncias, nmero de fragmentos amplificados e nmero de fragmentos polimrficos obtidos dos quatro acessos.

    Primer Sequncia 5 3 Fragmentos Amplificados

    Fragmenntos Polimrficos

    OPA 01 CAG GCC CTT C 17 6

    OPA 02 TGC CGA GCT G 16 8

    OPA 17 GAC CGC TTG T 6 3

    OPA18 AGG TGA CCG T 5 5

    OPF 05 CCG AAT TCC C 7 3

    OPAF 05 CCC GAT CAG A 6 3

    O critrio utilizado foi presena de bandas polimrficas que obtivessem

    uma melhor qualidade e visualizao dos produtos de amplificao para posterior

  • 45

    anlise. No resultado da RAPD pode-se observar que os acessos SC, Guadalupe e

    Seta, apresentaram similaridade gentica pelo padro de bandas evidenciado entre

    esses gentipos, no entanto, o acesso denominado Comum se diferenciou por

    apresentar bandas com padres diferentes dos demais acessos.

    Por meio do dendrograma formado (Figura 3), verificou-se a formao de

    dois grupos em que o acesso denominado Comum, ficou posicionado em um ramo,

    enquanto que os outros acessos (SC, Guadalupe e Seta), ficaram agrupados em

    outro ramo. Tambm foi observado que os acessos SC, Guadalupe e Seta podem

    ser considerados geneticamente iguais mediantes aos primers testados na anlise

    realizada pela tcnica de RAPD.

    Figura 3. Dendrograma de similaridade gentica, obtido a partir dos produtos de amplificao por RAPD do primer OPA 02 para quatro acessos de araruta.

    Com os resultados obtidos infere-se que o acesso Comum foi o mais

    divergente, se diferenciando dos acessos SC, Guadalupe e Seta, supondo que uma

  • 46

    mudana evolutiva devido distncia geogrfica, que segundo Slatkin (1987),

    eventualmente restringe o processo evolutivo por prevenir a adaptao s

    condies locais e promover a evoluo espalhando novos genes e combinaes

    gnicas entre populaes de uma determinada espcie. Esses acessos de Araruta

    podem apresentar variabilidade gentica ocasionada por mistura de sementes de

    outras populaes, por mutaes genticas ou cruzamentos naturais com plantas

    de diferentes gentipos.

    CONCLUSO

    Observou-se atravs das anlises de DNA barcoding, que todos os acessos

    testados so da espcie M.arundinacea e atravs da tcnica de RAPD conclui-se

    que h divergncia populacional entre o acesso Comum e os demais acessos.

    O presente trabalho envolvendo os quatro acessos de araruta Comum, SC,

    Guadalupe e Seta, nas tcnicas apresentadas pioneiro e possibilita a elaborao

    de novos estudos para que no futuro ocorra a probabilidade da descoberta de genes

    promissores, visando planejar os cruzamentos atravs do programa de

    melhoramento gentico de forma a aumentar as diversidades genticas entre

    gentipos de interesse.

  • 47

    REFERNCIAS BIBLIOGRFICAS

    ANDERSSON L.. Revision of Maranta subgen. Maranta (Marantaceae). Nordic Journal of Botany,v. 6, n.6, p.729756, 1986.

    ARNS, Y.K.N. Estudo Taxonmico dos grupos Monotagma, Maranta e Myrosma (Marantaceae) em Pernambuco. 1997.105p. Dissertao de Mestrado Biologia Vegetal. Universidade Federal de Pernambuco, Pernambuco,1997.

    BARBOSA, M. M. Quantificao e controle da qualidade do DNA genmico. In: MILACH, S.ed. Marcadores moleculares em plantas. Porto Alegre, 1998. p.99-106.

    BONATO, A. L. V.; VERZIGNASSI,J. R.;RESENDE, R.M.S.; FERNANDES,C.D.; LEGUIZAMON, G. O. de C. Extrao de DNA genmico de Stylosanthes spp. Campo Grande: Embrapa Gado de Corte, 2002. 4p. (Comunicado tcnico, 78).

    CHASE, M.W.; COWAN, R.S.; HOLLINGSWORTH, P.M.; BERG, C.; MADRINAN, S.; PETERSEN, G.;SEBERG, O.; JORGSENSEN, T.; CAMERO, K.M.; CARINE, M.; PEDERSEN, N.; HEDDERSON, T.A.J.;CONRAD, F.;SALAZAR, G.A.; RICHARDSON, J.E.;HOLLINGSWORTH, M.L.; BARRACLOUGH, T.G.; KELLY,L. ; WILKINSON, M. A proposal for a standardized protocol to barcode all land plants. Taxon 56, v.2, n.2, p. 295299, 2007.

    COUCH, J. A; FRITZ, P. J. Isolation of DNA from plants high in polyphenolics. Plant Molecular Biology Reporter, v.8, p.8-12, 1990.

    FARALDO, M.I.F. Marcadores moleculares em mandioca. In: CEREDA, M.P. Agricultura: Tuberosas Amilceas Latino Americano, So Paulo: Fundao Cargill, 2003. v.2, p.101-117. FUKUDA, W. M. G.; CAVALCANTI J.; COSTA I.R.S. . Variabilidade gentica e melhoramento da mandioca (Manihot esculenta Crantz). Recursos Genticos e Melhoramento de Plantas para o Nordeste Brasileiro. 1994. Disponvel em: . Acesso: 03 de novembro de 2014. HALL, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series: Oxford Journals, v. 41, p. 95-98, 1999.

    HERBERT, P.D.N; RATNASINGHAM, S.; DeWAARD J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. The Royal Society, v.270, n.1, p. 9699, 2003.

  • 48

    KENNEDY, H. Systematics and pollination of the closedflowered species of Calathea (Marantaceae). University of California Publications in Botany, 1977. v.71, p.190. KENNEDY, H. New species of Calathea (Marantaceae) endemic to Costa Rica. Canadian Journal of Botany, v.75, n.8, p.1356-1362, 1997. KENNEDY, H. Diversification in pollination mechanisms in the Marantaceae. In: Wilson, KL, Morrisson DA, (ed). Monocots Systematics and evolution. Melbourne: CSIRO, 2000, p.335343. KIMURA, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, v.16, p.111-120, 1980. LAHAYE, R.; van der BANK, M.; BOGARIN, D.; WARNER, J.; PUPULIN, F.; GIGOT, G.; MAURIN, O.; DUTHOIT, S.; BARRACLOUGH, T. G.; SAVOLAINEN, V. DNA Barcoding the floras of biodiversity hotspots. Proceedings of the National Academy of Sciences, v. 105, n. 8, p. 2923-2928, 2008. LEPAGE, R.; BILLARD, L. Exploring the limits of bootstrap. New York: John Wiley and Sons, 1992. p.632. LIU, K.J.; MUSE, S.V. PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics, v.21, n.9, p. 2128-2129, 2005.

    MENEZES, C.C.E. et al. Anlise da pureza gentica e discriminao de cultvares de vinca (Catharanthus roseus(L.) G. Don) usando Randon Amplified Polymorphic DNA em DNA extrado de sementes e folhas. Revista Brasileira de Sementes, v. 24, n. 1, p. 279-285, 2002. MONTEIRO, D. A.; PERESSIN, V. A. Cultura da araruta. In:CEREDA, M. P. (Coord.). Agricultura: tuberosas amilceas Latino Americanas. So Paulo: Fundao Cargill, 2002, v. 2, p. 440-447.

    NASS, L.L. Utilizao de recursos genticos vegetais no melhoramento. In: NASS,L.L.; VALOIS, A.C.C.; VALADARES- INGLIS, M.C.(Ed.). Recursos genticos e melhoramento, 2001. Porto Alegre: Grfica Editora Pallotti, Fundao de Apoio Pesquisa de Mato Grosso, Cap.2, p 29-55. NEI M. e KUMAR S. Molecular Evolution and Phylogenetics. Oxford University Press, 2000.

    NEVES, M. C. P.; COELHO, I. S.; ALMEIDA, D. L. Araruta; resgate de um cultivo tradicional. Rio de Janeiro: Seropdica RJ: EMBRAPA, 2005, 4p (Seropdica RJ: EMBRAPA Comunicado tcnico 79).

  • 49

    RStudio (2012). RStudio: Integrated development environment for R (Version 0.98.1091 2009-2014 RStudio, Inc). Computer software. Boston, MA., 2012.

    SAGHAI-MAROOF, M.A.; SOLIMAN, K.M.; JORGENSEN, R.A.; ALLARD, R.W. Ribosomal DNA spacer length polymorphism in barley: Mendelian inheritance, chromosome location and population dynamics. Proceedings of the National Academy of Sciences of the U.S.A, v.89, n.2, p.1477-1481, 1984.

    SAITOU N. e NEI M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, v. 4, n.4, p.406-425, 1987.

    . SLATKIN, M. Gene Flow and the Geographic Structure of Natural Populations. Science, v. 236, n.4803, p.787-792, 1987.

    SOLTIS D.E. e SOLTIS P.S. Choosing an approach and an appropriate gene for phylogenetic analysis. In: Soltis D.E.; Soltis P.M.; Doyle J.J. (ed) Molecular systematics of plants. II. DNA sequencing. Kluwer Academic Publishers, Dordrecht, 1998, p. 2124 SOUZA, V. C.; LORENZI, H. Botnica Sistemtica: guia ilustrado para identificao das famlias de Angiospermas da flora brasileira, baseado em APG II. Nova Odessa, Instituto Plantarum, 2005. 640p.

    . TAUTZ, D.; ARCTANDER, P.; MINELLI, A.; THOMAS, R. H.; VOGLER, A. P. Aplea for DNA taxonomy. Trends in Ecology e Evolution, v.18, n.2, p.7074, 2003. TAMURA K.; STECHER G.; PETERSON D.; FILIPSKI A.; and KUMAR S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0.Molecular Biology and Evolution, v.30, p. 2725-2729, 2013.

    VIEIRA, S. e SOUZA, V.C. Four new species of Maranta L. (Marantaceae) from Brazil. Botanical Journal of the Linnean Society, v.158, n.1, p.131139, 2008.

    WATERHOUSE, A.M.; PROCTER, J.B.; MARTIN, D.M.A; CLAMP, M. and BARTON, G. J. "Jalview Version 2 - a multiple sequence alignment editor and analysis workbench" Bioinformatics, v.25 n.9 p.1189-1191,2009. WEEDEN, N.F. Inheritance and reliability of RAPD markers. In: SYMPOSIUM ON APPLICATIONS OF RAPD TECHNOLOGY TO PLANT BREEDING, 1.,1992, Minneapolis. Anais. Minneapolis: Crop Science Society of America/American Society for Horticultural Science/American Genetic Association, 1992. p. 12.

  • 50

    WILLIAMS, J.G.K.; KUBELIK, A.R.; LIAK, K.J.; RAFALSKI, J.A.; TINGEY, S.V. DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, v.18, n.22, p.6531-6535, 1990. WOLFE, K.H.; LI, W.H. e SHARP, P.M. (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast and nuclear DNAs. Proceedings of the National Academy of Sciences of the USA, v.84, n.24, p. 90549058, 1987. YU, J.; XUE, J. H.; ZHOU, S. L. New universal matK primers for DNA Barcoding angiosperms. Journal of Systematics and Evolution, v.49, n.3, p.176-181, 2011.

  • 51

    APNDICES

    Tabela 1. Anlise do acesso de Araruta Comum comparadas com sequncias depositadas no BOLD Systems de RbcL

    Match

    Rank Family Genus Species Score Similarity E-Value Status

    1 Marantaceae Maranta arundinacea 483 100 0 Published

    2 Marantaceae Maranta arundinacea 483 100 0 Published

    3 Marantaceae Maranta arundinacea 483 100 0 Published

    4 Marantaceae Maranta arundinacea 483 100 0 Private

    5 Marantaceae Maranta arundinacea 483 100 0 Private

    Tabela 2. Anlise das sequncias SC, Guadalupe e seta comparadas com sequncias depositadas no BOLD Systems de rbcL

    Match

    Rank Family Genus Species Score Similarity E-Value Status

    1 Marantaceae Maranta arundinacea 478 100 0 Published

    2 Marantaceae Maranta arundinacea 478 100 0 Published

    3 Marantaceae Maranta arundinacea 478 100 0 Published

    4 Marantaceae Maranta arundinacea 478 100 0 Published

    5 Marantaceae Maranta arundinacea 478 100 0 Published

    Tabela 3. Anlise das sequncias Comum, SC, Guadalupe e seta comparadas com sequncias depositadas no BOLD Systems de matK

    Match

    Rank Family Genus Species Score Similarity E-Value Status

    1 Marantaceae Maranta arundinacea 373 99.66 2.2251926421931E-

    18

    Published

    2 Marantaceae Maranta bicolor 365 98.31 1.8538385838702E-

    17

    Published

    3 Marantaceae

    365 98.31 1.8538385838702E-

    17

    Published

    4 Marantaceae Ctenanthe marantifolia 363 98.31 1.8538385838702E-

    17

    Published

    5 Marantaceae Ctenanthe setosa 363 98.31 1.8538385838702E-

    17

    Published

  • 52

    Figura 1. Resultado do sequenciamento do gene rbcL dos quatro acessos de M. arundinacea.

  • 53

    Continuao -Figura 1. Resultado do sequenciamento do gene rbcL dos quatro acessos de M.

    arundinacea.

  • 54

    Figura 2. Resultado do sequenciamento do gene matK, dos quatro acessos de M. arundinacea.

    .

  • 55

    Continuao- Figura 2. Resultado do sequenciamento do gene matK, dos quatro acessos de M.

    arundinacea.

  • 56

    Figura 3. Padro eletrofortico obtido com primers OPF5 e OPAF5. PM: Peso Molecular 1kb plus.

    CO: araruta Comum. SC:Araruta SC. G: araruta Guadalupe e ST: araruta Seta, C- controle negativo.

  • 57

    Figura 4. Padro eletrofortico obtido com primers OPA1 e OPA2. PM: Peso Molecular 1kb plus. CO:

    araruta Comum. SC:Araruta SC. G: araruta Guadalupe e ST: araruta Seta, C- controle negativo.

  • 58

    Figura 5. Padro eletrofortico obtido com primer OPA17. PM: Peso Molecular 1kb plus. CO: araruta

    Comum. SC:Araruta SC. G: araruta Guadalupe e ST: araruta Seta, C- controle negativo.

Recommended

View more >