Biologia Anabolismo Nuclear Divisao Celular

  • Published on

  • View

  • Download


Biologia Anabolismo Nuclear Divisao Celular


Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito. Todos os direitos reservados. Material de apoio para Aula ao Vivo Anabolismo Nuclear e Diviso Celular Professor: Rubens Oda 14/04/2014 Anabolismo Nuclear e Diviso Celular 1. (UFRN) Uma protena X codificada pelo gene Xp sintetizada nos ribossomos, a partir de um RNAm.Paraqueasnteseacontea,necessrioqueocorram,noncleoenocitoplasma, respectivamente, as etapas dea) iniciao e transcrio.b) iniciao e terminao.c) traduo e terminao.d) transcrio e traduo. 2.(UFRGS)MeselsoneStahl,em1957,fizeramumexperimentosobreareplicaodoDNA. Nesseexperimento,abactriaEscherichiacolifoicultivada,pormuitasgeraes,emmeio contendoumistopopesadodenitrognio, 15N,attodooseuDNAestarmarcadocomesse istopo.Depoisdisso,asbactriasforamtransferidasparaummeiocontendonitrognioleve, 14N. As molculas de DNA foram ento isoladas e analisadas com relao ao seu contedo de 15N e de 14N, sendo observado o seguinte: Com relao a esses dados, podemos concluir que:a) a replicao do DNA semiconservativa.b) a replicao do DNA conservativa.c) a replicao do DNA randmica.d) no ocorreu replicao do DNA mas, sim, uma mutao.e) no ocorreu replicao do DNA mas, sim, transcrio. 3. (UNIFESP-SP) Analise a figura Afigurarepresentaumcromossomoemmetfasemittica.Portanto,osnmerosIeII correspondem a: a) cromossomos emparelhados na meiose, cada um com uma molcula diferente de DNA. b) cromtides no-irms, cada uma com uma molcula idntica de DNA. c) cromtides-irms, cada uma com duas molculas diferentes de DNA. d) cromtides-irms, com duas molculas idnticas de DNA. Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito. Todos os direitos reservados. Material de apoio para Aula ao Vivo Anabolismo Nuclear e Diviso Celular Professor: Rubens Oda 14/04/2014 Afigurarepresentaumcromossomoemmetfasemittica.Portanto,osnmerosIeII correspondem a: a) cromossomos emparelhados na meiose, cada um com uma molcula diferente de DNA. b) cromtides no-irms, cada uma com uma molcula idntica de DNA. c) cromtides-irms, cada uma com duas molculas diferentes de DNA. d) cromtides-irms, com duas molculas idnticas de DNA. e) cromossomos duplicados, com duas molculas diferentes de DNA. 4. (UEL) Considere as seguintes fases da mitose: I. telfase II. metfase III. anfase Considere tambm os seguintes eventos: a. As cromtides-irms movem-se para os plos opostos da clula. b. Os cromossomos alinham-se no plano equatorial da clula. c. A carioteca e o nuclolo reaparecem. Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza. a) I -a; II -b; III -c b) I -a; II -c; III -b c) I -b; II -a; III -c d) I -c; II -a; III -b e) I -c; II -b; III -a 5. (UFRS) Considere as afirmaes a seguir, referentes aos cromossomos homlogos. I. Durante a mitose e a meiose, quando os cromossomos so visveis como entidades distintas, os membrosdeumpardehomlogossodemesmotamanhoeexibemlocalizaocentromrica idntica. II. Durante os estgios iniciais da meiose, os cromossomos homlogos pareiam. III. Cromossomos homlogos so os que contm os mesmos alelos para cada loco gnico. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) I, II e III. Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito. Todos os direitos reservados. Material de apoio para Aula ao Vivo Anabolismo Nuclear e Diviso Celular Professor: Rubens Oda 14/04/2014 6.(UFT)AsatividadescelularessoorientadaspelasinformaescontidasnoDNA,queso decodificadas em protenas atravs dos mecanismos de transcrio e traduo. O quefazumabaleiaparecerumabaleiasosuasprotenas.Assim,asprotenasdeterminamas funesvitaisdabaleia,comodetodososseresvivos.Paraditarodesenvolvimentodeum organismo,ainformaodoDNAdeve,dealgummodo,serconvertidaemprotenas.Esta converso ocorre porque o DNA contm um cdigo gentico para os aminocidos que compem asprotenas.Nestecdigo,cadaaminocidorepresentadoporumasequnciadeparesde bases,eestasequnciarefletidanasequnciadeaminocidosreunidosemumacadeia proteica. Assim, traduzir o cdigo gentico significa passar o cdigo desequncia de bases para uma sequncia de aminocidos. Destemodo,oDNAdecodificadonaformadeumaprotenaestruturalouenzimticaque,por sua vez, responsvel por uma caracterstica do organismo. Podemos afirmar que:I.Estadecodificaosefazatravsdaleituradesequnciasdetrsnucleotdeos,chamados cdons, que especificam aminocidos.II.Oscdonsdiferementrediferentestxonsdeseresvivos;hcdonsquenocodificam aminocidos.III. A decodificao ocorre no citoplasma celular, em estruturas chamadas ribossomos, a partir de uma fita simples de DNA que deixa momentaneamente o ncleo somente para tal funo.IV. Cada cdon traduz apenas um aminocido.V. Alguns aminocidos so codificados por mais de um cdon. A isto chamamos degenerao do cdigo, o que possivelmente traz maior estabilidade contra mutaes no DNA. Indique a alternativa em que todas as afirmativas so falsas. a) I e IIIb) II, III e IVc) II e IIId) II, III e V 7.(UNIFESP)Noanode2009,o mundo foialvodapandemia provocadapelovrusinfluenzaA (H1N1), causando perdas econmicas, sociais e de vidas. O referido vrus possui, alm de seus receptoresproticos,umabicamadalipdicaeumgenomaconstitudode8genesdeRNA. Considerando: 1. a sequncia inicial de RNA mensageiro referente a um dos genes deste vrus: 5 AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3 Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito. Todos os direitos reservados. Material de apoio para Aula ao Vivo Anabolismo Nuclear e Diviso Celular Professor: Rubens Oda 14/04/2014 Responda: a) Qual ser a sequncia de aminocidos que resultar da traduo da sequncia inicial de RNA mensageiro, referente a um dos genes deste vrus indicada em 1? b) Considerando os mecanismos de replicao do genoma viral, qual a principal diferena entre o vrus da gripe e o vrus que causa a AIDS? Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito. Todos os direitos reservados. Material de apoio para Aula ao Vivo Anabolismo Nuclear e Diviso Celular Professor: Rubens Oda 14/04/2014 Gabarito 1.D 2.A 3.D 4.D 5.A 6.C 7. a) No esquea que h o cdon de iniciao (AUG) e o cdon de parada (UGA). Logo, o peptdeo traduzido tem a sequncia: MetioninaArginina Tirosina cido glutmico TriptofanoTirosinaAlanina Tirosina. b)AreplicaodovrusinfluenzaAH1N1envolveaenzimaRNA-polimerase,querealizaa replicaoatravsdosRNAsvirais.JoHIV,porserumretrovrus,utilizaaenzima transcriptasereversaparagerarumafitadeDNA-viral,queseintegraaoDNAdaclula hospedeira, e num dado momento passa a formar cpias do RNA-viral.


View more >